Chara baltica

Bruzelius · species

image placeholder — illustration coming later

Plantae/Charophyta/Charophyceae/Charales/Characeae/Chara

At a glance

Occurrence records5 896

Data sources7

Biological traits1

DNA specimens19

eDNA detections8

Sources7 archives

Databases and archives Chara baltica's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 644 records↗

OBISOcean Biodiversity Information System1 252 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics19 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF · OBIS5 896 records

Environmental DNA1 datasets · 4 countries8 detections

DNA & barcodingBOLD · NCBI19 specimens

01Narrative

Kustkransblad is een kranswier uit de familie Characeae. Het heeft zowel eenjarige als meerjarige vormen, afhankelijk van de groeidiepte. Vruchtbare planten worden gevonden van juni tot oktober, maar de vruchtbaarheid is normaal gesproken laag.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment1

Habitat freshwateryes

05DNA & barcoding19 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Chara baltica has left across the world's sequence archives.

At a glance

DNA specimens19

Marker genes4

GenBank sequences10

eDNA detections8

Countries6

The DNA barcodea real sequence read deposited for this species

rbcLMK791475.1 ↗1 051 bpGermany · 2010

ACGT

TGCAGTAGCTGCAGAATCTTCTACTGGTACATGGACTACTGTTTGGACTGACGGATTAACTAGTTTGGACCGATACAAAGGAAGATGCTA …

Chara baltica isolate Zi04 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK9★rbcL1★rbcLa★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type5 896 records

Wild obs. + sensor2 004

Museum / vouchered2 711

Cultivated / captive11

Other1 170

Origin

Native26

Range

Area of Occupancy AOO4 504 km²

Depth

0–200 m sunlit922

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 1 m · max 7 m · 922 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy95% within 1 km

≤100 m 1 316≤1 km 93≤10 km 77>10 km 3

1 489 georeferenced · 515 without coordinates

Open the mapobservation + sensor2 004

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy82% within 1 km

≤100 m 275≤1 km 546≤10 km 142>10 km 43

1 006 georeferenced · 1 705 without coordinates

Open the institutions mapphysical evidence2 711

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

>10 km 11

11 georeferenced

Open the mapnot free-living11

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions15 of 42 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Clocation not on record	442
730location not on record	402
Metsähallituslocation not on record	189
LDlocation not on record	180
Helsinki, FI	163
TÜ_EMIlocation not on record	124
South Kensington, GB	74
Uppsala, SE	68
Adam Mickiewicz University in Poznańlocation not on record	61
Bronx, US	46
SLU Artdatabankenlocation not on record	27
Uniwersytet Wrocławskilocation not on record	25
Olocation not on record	17
Butler Universitylocation not on record	17
Turku, FI	11
Edinburgh, GB	6
KMNlocation not on record	5
Senckenberg Institute for Plant Form and Function at Friedrich Schiller University Jenalocation not on record	5
Norwegian Institute for Water Researchlocation not on record	5
Burlington, US	4
BMlocation not on record	4
Durham, US	4
Jurica-Suchy Nature Museumlocation not on record	4
Oskarshamn, SE	3
Tartu, EE	3
Porvoo, FI	2
Frankfurt am Main	2
BSBIlocation not on record	2
BM\|Elocation not on record	2
B\|E\|MANCH\|NMW\|STAlocation not on record	1
Dorset County Museumlocation not on record	1
TROMlocation not on record	1
TUR-Alocation not on record	1
Elocation not on record	1
BM\|E\|NMWlocation not on record	1
BM\|RNGlocation not on record	1
University of St Andrews Herbariumlocation not on record	1
Bourges, FR	1
MAlocation not on record	1
Champaign, US	1
Ann Arbor, US	1
BM\|E\|MANCH\|NMW\|SLBI\|STAlocation not on record	1

42 institutions · 1 910 of 2 711 vouchered records shown · 792 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA8 detections

Where the DNA of Chara baltica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map4 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median9.10 °C 3.50–15.0

Seasonal swing summer↔winter20.4 °C

Max temp (day)12.9 °C 6.80–17.8

Min temp (night)4.80 °C -0.1–11.6

Precipitation61.7 mm/mo 56.7–71.0

Air humidity63.2 % 58.4–63.7

Moisture balance-8.60 mm/mo -46.3–17.8

Vapour deficit468 Pa 351–708

Wind speed2.70 m/s 2.40–4.20

Cloud cover45.4 % 38.8–51.4

CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Chara baltica

At a glance

Sources7 archives

Habitat & environment1

At a glance

Record type5 896 records

Origin

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions15 of 42 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type5 896 records