Chaptalia nutans

(L.) Hemsl. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Chaptalia

At a glance

Occurrence records673

Data sources11

Biological traits13

DNA specimens9

eDNA detections7

Sources11 archives

Databases and archives Chaptalia nutans's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility673 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

NCBIUS National Library of Medicinesequences↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources13 traits

Chemical compositionNPASS12 compounds

Occurrence & distributionGBIF673 records

Environmental DNA1 datasets · 2 countries7 detections

DNA & barcodingBOLD · NCBI9 specimens

Genome at a glanceCCDB2n = 48

01Narrative

Chaptalia nutans là một loài thực vật có hoa trong họ Cúc. Loài này được (L.) Polák mô tả khoa học đầu tiên năm 1877.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction3

Life formperennial

Life spanperennial

Raunkiær life formhemicryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max2 800 m

Elevation min0 m

Epiphyteterrestrial

Growth formherb

Habitat GIFTÁrea Antrópica, Campo de Altitude, Campo Limpo, Cerrado (lato sensu), Floresta Estacional Decidual, Floresta Estacional Semidecidual, Floresta Ombrófila (= Floresta Pluvial), Floresta Ombrófila Mista

Woodinessnon-woody

03Chemical composition12 compounds

Compounds documented for Chaptalia nutans across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Miscellaneous meroterpenoids4

Indole-Diterpenoid alkaloids (Penitrems)3

Triketide meroterpenoids3

Pyridine alkaloids $ Triketide meroterpenoids1

Halimane diterpenoids1

Documented compounds12 total

Tissue Source Quantified only

Compound	Amount	Source
(2S,4aS,4bR,6aS,12bS,12cS,14aS)-3,4,4a,4b,5,6,6a,7,12,12b,12c,13,14,14a-Tetradecahydro-alpha,alpha,4a,12b,12c-pentamethyl-2H-1-benzopyrano(5',6':6,7)indeno(1,2-b)indole-2-methanol	present	NPASS
15-Deoxyoxalicine A	present	NPASS
2-[(1R,2'R,12R,15R,16R,20S)-2',15-dihydroxy-1,20-dimethyl-3',17-dioxospiro[3-azapentacyclo[10.8.0.02,10.04,9.015,20]icosa-2(10),4,6,8-tetraene-16,5'-oxolane]-2'-yl]propan-2-yl acetate	present	NPASS
2-[(1R,2'R,12R,15R,16R,20S)-2',15-dihydroxy-17-methoxy-1,20-dimethyl-3'-oxospiro[3-azapentacyclo[10.8.0.02,10.04,9.015,20]icosa-2(10),4,6,8,17-pentaene-16,5'-oxolane]-2'-yl]propan-2-yl acetate	present	NPASS
Decaturin B	present	NPASS
Decaturin D	present	NPASS
Emindole Sb	present	NPASS
Oxalicine B	present	NPASS
Paxilline	present	NPASS
Thiersindole A	present	NPASS

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Chaptalia nutans has left across the world's sequence archives.

At a glance

DNA specimens9

Marker genes5

GenBank sequences7

eDNA detections7

Countries2

The DNA barcodea real sequence read deposited for this species

ITSAF546087.1 ↗642 bp

ACGT

TCGAAACCTGCCTAGCAGAACGACCCGTGGACACGTATTCAAAACCGGGCGTTGTGGGGACGGGGCCACGGCCTCTACCATACGCCCTGT …

Chaptalia nutans internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL3★rbcLa★ITS2★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Chaptalia nutans carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 48 n = 24

Ploidypolyploid inferred

Chromosome records48–502n range48median48mode6records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 484×CCDB · croinout · CCDB · book-ipcn67-71

CCDB · croinout — Torres, A. M. & Liogier, A. H. 1970

CCDB · croinout — Baldmin, J. T. & Speese, B. M. 1947

CCDB · croinout — Turner, B. L. 1959

CCDB · book-ipcn67-71 — TORRES, A.M., & A.H. LIOGIER. 1970. Chromosome numbers of Dominican Compositae. Brittonia 22: 240-245.

2n 502×CCDB · croinout · CCDB · ipcn-api-dl

CCDB · croinout — Teppner, H. & Tropper, S. 1984

CCDB · ipcn-api-dl — Teppner, H. & S. Tropper. 1984. Chromosomen und chromatin-typen bei Chaptalia nutans (Asteraceae-Mutisieae). Kurzfassungen (der Beitr;auage). Botaniker-Tagung, Deutscher Botanische Geselschaft Wien,. September 1984: 8.

n 245×CCDB · croinout · CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 +1

CCDB · croinout — Coleman, R. 1968

CCDB · croinout — Hunziker, J. H., Wulff, A., Xifreda, C. C. & Escobar, A. 1989

CCDB · ipcn-api-dl — Hunziker, J. H., A. Wulff, C. C. Xifreda & A. Escobar. 1989. Estudios cariológicos en Compositae V. Darwiniana 29: 25–39.

CCDB · book-ipcn67-71 — COLEMAN, R. 1968. Chromosome numbers in some Brazilian Compositae. Rhodora 70: 228-240.

CCDB · Cave1959 — Turner 1959a

n 252×CCDB · croinout · CCDB · ipcn-api-dl

CCDB · croinout — Teppner, H. & Tropper, S. 1984

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type673 records

Wild obs. + sensor521

Museum / vouchered148

Cultivated / captive1

Other3

Origin

Native15

Range

Area of Occupancy AOO2 044 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 236≤1 km 64≤10 km 29>10 km 27

356 georeferenced · 165 without coordinates

Open the mapobservation + sensor521

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy25% within 1 km

≤100 m 3≤1 km 12≤10 km 34>10 km 10

59 georeferenced · 89 without coordinates

Open the institutions mapphysical evidence148

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 32 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Universidad de Antioquia (UdeA)location not on record	21
Austin, US	17
Wuzhou, CN	12
Bronx, US	11
CEPLAClocation not on record	9
Universidad de Caldas (UCaldas)location not on record	9
ASUlocation not on record	7
UNESP-ISlocation not on record	5
Altos de Pipe, VE	5
EL PASO, US	4
Uniwersytet Śląski w Katowicachlocation not on record	4
Chongqing Museumlocation not on record	4
Area de Conservacion Guanacastelocation not on record	3
Universidad Industrial de Santander (UIS)location not on record	3
INBIOlocation not on record	3
Universidad de La Salle (La Salle)location not on record	3
Masindi, UG	2
FUNEDlocation not on record	2
Universidade Federal de Sergipe (UFS)location not on record	2
Fort Worth, US	2
Bloomington, US	2
Guatemala City, GT	2
Moscow State Universitylocation not on record	1
Fredericksburg, US	1
Ilhéus, BR	1
Loja, EC	1
Departamento de Sistematica e Ecologialocation not on record	1
US	1
Universidad de la Amazonia (UniAmazonia)location not on record	1
Pontificia Universidad Javeriana (PUJ)location not on record	1
Universidad del Valle (UV)location not on record	1
BAYLUlocation not on record	1

32 institutions · 142 of 148 vouchered records shown · 5 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA7 detections

Where the DNA of Chaptalia nutans was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.7 °C 18.5–24.7

Seasonal swing summer↔winter2.50 °C

Max temp (day)27.7 °C 23.5–27.7

Min temp (night)21.9 °C 14.6–21.9

Precipitation313 mm/mo 140–313

Air humidity69.3 % 59.1–69.3

Moisture balance166 mm/mo 14.8–166

Vapour deficit950 Pa 897–950

Wind speed2.90 m/s 2.90–3.50

Cloud cover46.0 % 32.8–46.0

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)