Championia reticulata

Gardner · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Gesneriaceae/Championia

At a glance

Occurrence records7

Data sources4

Biological traits2

DNA specimens0

eDNA detections0

Sources4 archives

Databases and archives Championia reticulata's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility7 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF7 records

DNA & barcodingNCBIsequences

01Narrative

Хампиония (лат. Championia) — монотипный род двудольных растений семейства Геснериевые (Gesneriaceae). Единственный представитель — хампиония сетчатая, впервые описанная британским ботаником Джорджем Гарднером в 1846 году. Род назван в честь Джона Джорджа Чэмпиона, британского ботаника и военного деятеля.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVP

Life cycle & reproduction1

Life formsubshrub

Habitat & environment1

Climatewet tropical

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Championia reticulata has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

Countries1

The DNA barcodea real sequence read deposited for this species

matKOR962840.1 ↗1 536 bpSri Lanka

ACGT

GGTTAATTGCTCGAATGTATCAACAGAATTCTTTTCTTATTTCTCCTTCTAATAAAAATCCCTTTTTGGGACGCAACAAGAATTTGTATT …

Championia reticulata voucher S.Ranasinghe SR1027c, KTUa.LK (E,PDA) tRNA-Lys (trnK) gene, intron; and maturase K (matK) pseudogene, partial sequence; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1

plant barcode

08Occurrence & distribution

Record type7 records

Wild obs. + sensor2

Museum / vouchered5

Range

Area of Occupancy AOO20 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy50% within 1 km

≤1 km 1≤10 km 1

2 georeferenced

Open the mapobservation + sensor2

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 5 records without

Open the institutions mapphysical evidence5

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Stellenboschlocation not on record	2
Stockholm, SE	1

2 institutions · 3 of 5 vouchered records shown · 2 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)