Champereia manillana

(Blume) Merr. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Santalales/Opiliaceae/Champereia

At a glance

Occurrence records2 471

Data sources9

Biological traits32

DNA specimens33

eDNA detections15

Sources9 archives

Databases and archives Champereia manillana's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 471 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI15 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics33 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources32 traits

Occurrence & distributionGBIF2 471 records

Environmental DNA1 datasets · 1 countries15 detections

DNA & barcodingBOLD · NCBI33 specimens

01Narrative

Champereia is a genus of plants in the family Opiliaceae described as a genus in 1843.Griffith, William. 1843. Calcutta Journal of Natural History and Miscellany of the Arts and Sciences in India 4: 237Tropicos, Champereia Griff. It contains only one known species, Champereia manillana, native to China (Guangxi, Yunnan), Taiwan, Southeast Asia, New Guinea, and Christmas Island.Kew World Checklist of Selected Plant FamiliesFlora of China Vol. 5 Page 206 台湾山柚 tai wan shan you Champereia manillana (Blume) Merrill, Philipp. J. Sci., C. 7: 233. 1912. Varieties Champereia manillana var. longistaminea (W.Z.Li) H.S.Kiu - Yunnan, Guangxi Champereia manillana var. manillana - Taiwan, Southeast Asia, New Guinea, and Christmas Island

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology13

Fruit length12.5 mm

Fruit length max15 mm

Fruit length min10 mm

Leaf length75 mm

Leaf length max100 mm

Leaf length min50 mm

Leaf size1 483 mm²

Leaf width30 mm

Leaf width max35 mm

Leaf width min25 mm

Plant height6.25 m

⚠ sources differ — GIFT: 6.25 m · TRY: 7 m

Plant height max10 m

Plant height min2 m

Life cycle & reproduction4

Deciduousnessevergreen

Life formshrub or tree

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Growth formtree

Woodinesswoody

Physiology & chemistry8

Leaf C:N ratio14.27 g/g

Leaf c492 mg/g

Leaf n34.5 mg/g

Leaf p6.2 mg/g

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)10.69 mm²/mg

Wood density672 mg/cm³

05DNA & barcoding33 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Champereia manillana has left across the world's sequence archives.

At a glance

DNA specimens33

Marker genes6

GenBank sequences10

eDNA detections15

Countries2

The DNA barcodea real sequence read deposited for this species

rbcLMH390678.1 ↗1 428 bp

ACGT

ATGTCACCACAAACAGAGACTAAAGCAAGTGTTGGATTCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGATTATGAA …

Champereia manillana voucher D. Nickrent 4128 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, complete cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK8★rbcL2★rbcLa★ITS★ITS2trnH-psbA

plant barcodefungal barcodemarker

08Occurrence & distribution

Record type2 471 records

Wild obs. + sensor2 041

Museum / vouchered404

Other26

Origin

Native21

Range

Area of Occupancy AOO2 428 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 1 023≤1 km 133≤10 km 61>10 km 14

1 231 georeferenced · 810 without coordinates

Open the mapobservation + sensor2 041

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 4≤1 km 2

6 georeferenced · 398 without coordinates

Open the institutions mapphysical evidence404

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions17 of 21 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Taipei, TW	120
Taipei, TW	24
TAIElocation not on record	21
Kew, GB	20
Cibinong Science Center, Herbarium Bogorienselocation not on record	14
Beijing, CN	11
Saint Louis, US	9
Llocation not on record	6
Cibinong, ID	5
Bronx, US	3
Pondicherry, IN	3
Edinburgh, GB	3
Paris, FR	2
Ann Arbor, US	2
University of Stellenboschlocation not on record	2
Guangzhou, CN	2
Fort Worth, US	2
Stockholm, SE	1
Nishihara, JP	1
Nanjing, CN	1
South Kensington, GB	1

21 institutions · 253 of 404 vouchered records shown · 151 without an institution code

09Environmental DNA15 detections

Where the DNA of Champereia manillana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found15

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 15 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.1 °C 24.6–26.6

Seasonal swing summer↔winter1.10 °C

Max temp (day)29.5 °C 27.5–30.0

Min temp (night)22.6 °C 22.6–23.0

Precipitation269 mm/mo 243–269

Air humidity68.1 % 66.4–68.9

Moisture balance133 mm/mo 102–133

Vapour deficit1,080 Pa 957–1,173

Wind speed1.20 m/s 1.20–1.50

Cloud cover57.6 % 54.2–61.8

CHELSA 1981–2010, ~9 km grid, at location & month of 11 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Champereia manillana

At a glance

Sources9 archives

Size & morphology13

Life cycle & reproduction4

Diet & foraging1

Habitat & environment6

Physiology & chemistry8

At a glance

Record type2 471 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions17 of 21 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 471 records