Chambeyronia macrocarpa

(Brongn.) Vieill. ex Becc. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Arecales/Arecaceae/Chambeyronia

At a glance

Occurrence records112

Data sources9

Biological traits24

DNA specimens3

eDNA detections3

Sources9 archives

Databases and archives Chambeyronia macrocarpa's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility112 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources24 traits

Occurrence & distributionGBIF112 records

Environmental DNA1 datasets · 0 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB2n = 32

01Narrative

Chambeyronia macrocarpa est une espèce de palmiers, des plantes de la famille des Arecaceae, endémique de Nouvelle-Calédonie, où elle est l'un des symboles de la biodiversité de l'archipel.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology4

Fruit length45 mm

Fruit width25 mm

Leaf length max2 500 mm

Plant height20 m

Life cycle & reproduction5

Deciduousnessevergreen

Dispersal typeanimal

Life formtree

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment7

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Fruit colourred

Growth formtree

Habitat GIFTcanopy

Woodinesswoody

Physiology & chemistry1

Photosynthetic pathwayC3

Other traits6

Dbh max27 cm

Defenseno

Leaf spinesno

Plant support typefree-standing

Shoot length max2 000 cm

Shoot orientationerect

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Chambeyronia macrocarpa has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes3

GenBank sequences10

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMK692167.1 ↗473 bp

ACGT

AATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCACCCGGTCGAGGGCACGCCTGCCTGGGCGTCACGC …

Chambeyronia macrocarpa voucher XMBG067 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL1★ITS6

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Chambeyronia macrocarpa carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 32 n = 16

Ploidypolyploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 321×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Johnson, M. 1985. New chromosome counts in the Palmae. Kew Bull. 40: 109–114.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type112 records

Wild obs. + sensor24

Museum / vouchered88

Origin

Introduced2

Range

Area of Occupancy AOO164 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy56% within 1 km

≤100 m 6≤1 km 3≤10 km 4>10 km 3

16 georeferenced · 8 without coordinates

Open the mapobservation + sensor24

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced · 87 without coordinates

Open the institutions mapphysical evidence88

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Paris, FR	73
Bronx, US	6
Tampa, US	3
Kew, GB	3
Miami, US	2
ASUlocation not on record	1

6 institutions · 88 of 88 vouchered records shown

09Environmental DNA3 detections

Where the DNA of Chambeyronia macrocarpa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)