Chamaesphecia bibioniformis

(Esper, 1800) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Sesiidae/Chamaesphecia

At a glance

Occurrence records239

Data sources7

Biological traits0

DNA specimens19

eDNA detections7

Sources7 archives

Databases and archives Chamaesphecia bibioniformis's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility239 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics19 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF239 records

Environmental DNA1 datasets · 2 countries7 detections

DNA & barcodingBOLD19 specimens

01Narrative

Chamaesphecia bibioniformis is a moth of the family Sesiidae. It is found in southern Europe (from Spain to southern Russia)Fauna Europaea and from Asia Minor to Kyrgyzstan. The wingspan is 19–21 mm. Adults are on wing in June and July. The larvae feed on Euphorbia species, including Euphorbia gerardiana, Euphorbia sequieriana, Euphorbia myrsinites, Euphorbia angustifrons, Euphorbia serrata, Euphorbia nicaeensis, Euphorbia niciciana, Euphorbia pannonica and Euphorbia macroclada.Chamaesphecia at funet

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding19 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Chamaesphecia bibioniformis has left across the world's sequence archives.

At a glance

DNA specimens19

BINs6

Marker genes1

eDNA detections7

Countries11

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus16 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 74% of positions are identical in every specimen.

Where individuals differ — all 170 variable positions, in barcode order

1Amostly conserved

2Amostly conserved

3Cmostly conserved

4Tmostly conserved

6Tmostly conserved

7Amostly conserved

9Amostly conserved

11Tmostly conserved

14Amostly conserved

17Tmostly conserved

18Tmostly conserved

19Tmostly conserved

20Gmostly conserved

21Gmostly conserved

22Amostly conserved

23Amostly conserved

24Tmostly conserved

25Tmostly conserved

26Tmostly conserved

27Gmostly conserved

28Amostly conserved

30Cmostly conserved

31Tmostly conserved

32Gmostly conserved

33Gmostly conserved

35Amostly conserved

37Amostly conserved

39Tmostly conserved

40Tmostly conserved

41Gmostly conserved

42Gmostly conserved

43Amostly conserved

46Tmostly conserved

47Amostly conserved

48Cmostly conserved

49Cvariable

50Cvariable

51Tmostly conserved

53Amostly conserved

54Gmostly conserved

55Amostly conserved

59Tmostly conserved

61Amostly conserved

62Amostly conserved

63Tmostly conserved

65Cmostly conserved

66Gmostly conserved

69Cmostly conserved

70Cvariable

71Gmostly conserved

72Amostly conserved

74Tvariable

75Tmostly conserved

76Gvariable

77Gmostly conserved

78Gmostly conserved

79Amostly conserved

80Amostly conserved

82Tmostly conserved

83Cmostly conserved

84Cmostly conserved

85Cvariable

86Gmostly conserved

87Gmostly conserved

88Amostly conserved

89Tmostly conserved

90Cmostly conserved

91Cvariable

92Tmostly conserved

94Amostly conserved

95Amostly conserved

96Tmostly conserved

97Tmostly conserved

98Gmostly conserved

99Gmostly conserved

100Cvariable

115Tmostly conserved

127Amostly conserved

135Amostly conserved

139Tmostly conserved

142Tmostly conserved

148Amostly conserved

152Tmostly conserved

160Amostly conserved

166Amostly conserved

178Tmostly conserved

181Amostly conserved

197Tmostly conserved

199Amostly conserved

202Tmostly conserved

205Cvariable

206Cvariable

208Gvariable

211Amostly conserved

214Gmostly conserved

217Amostly conserved

220Tvariable

223Tmostly conserved

226Tmostly conserved

232Tvariable

238Cmostly conserved

250Tmostly conserved

253Amostly conserved

262Avariable

263Cvariable

266Tmostly conserved

271Cmostly conserved

274Cmostly conserved

283Tmostly conserved

287Tmostly conserved

292Tmostly conserved

307Amostly conserved

316Amostly conserved

319Tmostly conserved

340Tmostly conserved

343Cmostly conserved

346Tvariable

352Amostly conserved

358Tvariable

373Amostly conserved

+50 more variable positions not shown

AACTTTATATTTTATTTTTGGAATTTGAGCTGGAATAGTTGGAACTACCCTAAGATTATTAATTCGTGCCGAATTGGGAACTCCCGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)7.8%

Haplotypes9

BINs6

Most divergent pair8.7%

EuropeAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Chamaesphecia kauttisame genus4.7%Chamaesphecia leucocnemissame genus5.2%Chamaesphecia iranicasame genus5.6%Chamaesphecia palustrissame genus6.5%Chamaesphecia maurusiasame genus6.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type239 records

Wild obs. + sensor123

Museum / vouchered91

Other25

Origin

Native1

Range

Area of Occupancy AOO644 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy55% within 1 km

≤100 m 39≤1 km 18≤10 km 37>10 km 10

104 georeferenced · 19 without coordinates

Open the mapobservation + sensor123

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy69% within 1 km

≤100 m 4≤1 km 50≤10 km 24

78 georeferenced · 13 without coordinates

Open the institutions mapphysical evidence91

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Provincia di Livornolocation not on record	52
Zürich, CH	19
Tartu, EE	4
ZSMlocation not on record	2
Bavarian State Collection of Zoologylocation not on record	2

5 institutions · 79 of 91 vouchered records shown · 12 without an institution code

09Environmental DNA7 detections

Where the DNA of Chamaesphecia bibioniformis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.5 °C -3.80–23.0

Seasonal swing summer↔winter19.5 °C

Max temp (day)21.2 °C 0.2–26.6

Min temp (night)10.1 °C -9.50–18.9

Precipitation30.3 mm/mo 27.1–57.5

Air humidity58.3 % 52.7–58.7

Moisture balance-127 mm/mo -140–14.7

Vapour deficit925 Pa 195–1,192

Wind speed3.60 m/s 1.20–3.80

Cloud cover32.3 % 28.5–50.4

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)