Chamaescilla corymbosa

(R.Br.) F.Muell. ex Benth. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Asphodelaceae/Chamaescilla

At a glance

Occurrence records4 085

Data sources6

Biological traits35

DNA specimens0

eDNA detections0

Sources6 archives

Databases and archives Chamaescilla corymbosa's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 085 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources35 traits

Occurrence & distributionGBIF4 085 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 44

01Narrative

Chamaescilla corymbosa là một loài thực vật có hoa trong họ Măng tây. Loài này được (R.Br.) F.Muell. ex Benth. mô tả khoa học đầu tiên năm 1870.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology13

Fruit length8 mm

Leaf length150 mm

Leaf mass per area15.84 g/m2

Leaf size1 031 mm²

Leaf width7 mm

Plant height0.3 m

Plant height max0.4 m

Plant height min0.05 m

Seed length1.7 mm

⚠ sources differ — TRY: 1.7 mm · AusTraits: 1.83 mm

Seed mass0.797 mg

Seed mass max0.81 mg

Seed mass min0.81 mg

Seed width4.72 mm

Life cycle & reproduction8

Dispersal typeundefined

Flowering timeynnnyyyyyyyy

Life formperennial or tuberous geophyte

Life spanperennial

Lifeform raunkiaer detailedgeophyte

Pollination syndromeinsect

Resprouting capacityresprouts

Sex typehermaphrodite+monoecious

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formherb

Leaf compoundnesssimple

Leaf shapelinear

Woodinessnon-woody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Chamaescilla corymbosa has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences2

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLKX421843.1 ↗466 bpAustralia

ACGT

GATTTAAAGATGGTGTTAAAGATTACAGATTGACTTATTATACTCCTGATTACGGAACCAAAGATACTGATATCTTGGCAGCATTCCGAG …

Chamaescilla corymbosa voucher MELU:M113170a ribulose-1,5-bisphosphate carboxylase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Chamaescilla corymbosa carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 44 n = 22

Chromosome records44–442n range44median44mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 444×CCDB · ipcn-api-dl · CCDB · book-fedorov · CCDB · book-atlas-flowering-plants

CCDB · ipcn-api-dl — Wiltshire, R. J. E. & W. D. Jackson. 2003. Index of chromosome numbers of Tasmanian spermatophytes. Pap. & Proc. Roy. Soc. Tasmania 137: 39–53.

CCDB · book-fedorov — Jackson W. D.

CCDB · book-fedorov — D. 1955)

CCDB · book-atlas-flowering-plants — W. D. Jackson unp.

08Occurrence & distribution

Record type4 085 records

Wild obs. + sensor3 865

Museum / vouchered216

Cultivated / captive4

Origin

Native34

Range

Area of Occupancy AOO7 236 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 1 961≤1 km 652≤10 km 176>10 km 199

2 988 georeferenced · 877 without coordinates

Open the mapobservation + sensor3 865

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy64% within 1 km

≤100 m 69≤1 km 26≤10 km 49>10 km 4

148 georeferenced · 68 without coordinates

Open the institutions mapphysical evidence216

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 1≤1 km 2

3 georeferenced · 1 without coordinates

Open the mapnot free-living4

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions15 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kensington, AU	125
Canberra, AU	34
Parkville, AU	10
Museo Entomologico de Leonlocation not on record	8
QVMAGlocation not on record	8
Palmerston, AU	5
Brisbane, AU	4
La Trobe Universitylocation not on record	4
Kew, GB	3
Adelaide, AU	3
US	2
Hobart, AU	2
Copenhagen, DK	2
Stockholm, SE	1
Clocation not on record	1
Mount Annan, AU	1
Auckland, NZ	1
Armidale, AU	1
Smithfield, AU	1

19 institutions · 216 of 216 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Chamaescilla corymbosa

At a glance

Sources6 archives

Size & morphology13

Life cycle & reproduction8

Diet & foraging1

Habitat & environment10

Physiology & chemistry2

Other traits1

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type4 085 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions15 of 19 geolocated

Cultivated / Captivenot free-living

Record type4 085 records