Chamaemelum fuscatum

(Gren. & Godr.) Vasc. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Chamaemelum

At a glance

Occurrence records3 000

Data sources12

Biological traits12

DNA specimens5

eDNA detections2

Sources12 archives

Databases and archives Chamaemelum fuscatum's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 000 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources12 traits

Chemical compositionLOTUS · NPASS80 compounds

Occurrence & distributionGBIF3 000 records

Environmental DNA1 datasets · 2 countries2 detections

DNA & barcodingBOLD · NCBI5 specimens

Genome at a glanceCCDB2n = 18

01Narrative

Chamaemelum fuscatum é uma espécie de planta com flor pertencente à família Asteraceae. A autoridade científica da espécie é (Brot.) Vasc., tendo sido publicada em Anais Inst. Vinho Porto 20: 276. 1966. Os seus nomes comuns são margaça-de-inverno, margaça-fusca ou pamposto.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology2

Plant height0.066 m

Seed mass0.167 mg

Life cycle & reproduction3

Life formannual

Life spanannual

Raunkiær life formtherophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

03Chemical composition80 compounds

Compounds documented for Chamaemelum fuscatum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Abietane diterpenoids15

Germacrane sesquiterpenoids7

Phthalide derivatives6

Wax monoesters3

Abietane diterpenoids $ Tetracyclic diterpenoids3

Documented compounds80 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-trans-Pinocarveol	present	LOTUS
(-)-alpha-Curcumene	present	LOTUS
(-)-Caryophyllene	present	NPASS
(-)-Syringaresinol	present	NPASS
(10S)-12-Methoxy-9,10-seco-9,20-cycloabieta-8,11,13-triene-10,11-diol	present	NPASS
(1R,11S)-5-methoxy-12,12-dimethyl-6-propan-2-yltricyclo[9.4.0.03,8]pentadeca-3,5,7-triene-1,4-diol	present	NPASS
(1R,8S,10S)-3,4-Dihydroxy-5-[(2R)-1-hydroxypropan-2-yl]-11,11-dimethyl-16-oxatetracyclo[6.6.2.01,10.02,7]hexadeca-2,4,6-trien-15-one	present	NPASS
(1R,8S,10S)-4-methoxy-11,11-dimethyl-5-propan-2-yl-16-oxatetracyclo[6.6.2.01,10.02,7]hexadeca-2,4,6-trien-3-ol	present	NPASS
(1S,2S,5R,8R,9R)-4,4,8-trimethyltricyclo[6.3.1.01,5]dodecane-2,9-diol	present	NPASS
(2-Methylidene-3-oxobutyl) 2-methylprop-2-enoate	present	LOTUS

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Chamaemelum fuscatum has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes5

GenBank sequences6

eDNA detections2

Countries2

The DNA barcodea real sequence read deposited for this species

ITSAJ420093.1 ↗205 bpSpain

ACGT

ATCGCGTCGCCCCCCACAAATCTTTGTTGGGGGCGGATATTGGTCTCCCGTGCTAATGGCGTGGTTGGCCAAAATAGGAGTCCCTTCGAT …

Chamaemelum fuscatum internal transcribed spacer 2 (ITS2), specimen voucher Sundermeier A11 (B)

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcL2★ITS4★ITS1★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Chamaemelum fuscatum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidydiploid inferred

Chromosome records18–322n range18median18mode13records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 1812×CCDB · ita-fl · CCDB · iber-fl · CCDB · ipcn-api-dl +4

CCDB · ita-fl — BRULLO S., MAJORANA G., PAVONE P., ZIZZA A. - 1978. Numeri cromosomici per la flora italiana:375-381.. Inform. Bot. Ital. , 10(1): 57-63.

CCDB · iber-fl — Contribuiao para o conhecimento citotaxonmico das spermatophyta de Portugal. II. Compositae, supl. 1 Queirs, M.Bol. Soc. Brot. ser. 247: 299-314(1973).

CCDB · iber-fl — Sur la caryologie de quelques plantes rcoltes pendant la III Reunion de Botanique Pninsulaire. Fernandes, A. & M. Queirs.Mem. Soc. Brot.21: 343-385(1971).

CCDB · ipcn-api-dl — Nagl, W. & F. Ehrendorfer. 1974. DNA content, heterochromatin, mitotic index and growth in perennial and annual Anthemideae (Asteraceae). Pl. Syst. Evol. 123: 35–54.

CCDB · ipcn-api-dl — Brullo, S., G. MAJORANA, P. Pavone & M. C. Terrasi. 1978. Numeri cromosomici per la Flora Italiana. Inform. Bot. Ital. 10: 46 and 80.

CCDB · ipcn-api-dl — Vogt, R. & C. Oberprieler. 1993. Chromosome numbers of north African phanerograms. I. Fl. Medit. 3: 187–210.

CCDB · ipcn-api-dl — Vázquez, F. M., S. Ramos, E. Doncel, J. Blanco & E. Balbuena. 2001. IOPB chromosome data 17. Newslett. Int. Organ. Pl. Biosyst. (Pruhonice) 33: 26.

CCDB · book-ipcn67-71 — FERNANDES, A., & M. QUEIROS. 1971. Contribution a la connaissance cytotaxinomique des Spermatophyta du Portugal. II Compositae Bol. soc. Brot. 45 (ser. 2l: 5-122.

CCDB · book-ipcn67-71 — FERNANDES, A., & M. QUEIROS. 1970-71. Sur la caryologie de quelque plantes recoltees pendant la Illeme reunion de botanique peninsulaire. Mem. Soc. Broteriana 21: 343-385.

CCDB · book-ipcn73-74 — QUEIROS, M. 1973. Contribuicao para o conhecimento citotaxonomico dJ spermatophyta de Portugal. 47(Ser. 2l: 299-314. II Compositae, supl. I Bol. Soc. Brot. I

CCDB · eflora

CCDB · kew — Nagl W, Ehrendorfer F. 1974. DNA content, heterochromatin, mitotic index, and growth in perennial and annual Anthemidea (Asteraceae). Plant Systematics and Evolution 123: 35-54.

2n 321×CCDB · book-indian_vol1

CCDB · book-indian_vol1 — Mehra, P.N. & Remanandan, P. 1974

n 162×CCDB · book-ipcn67-71 · CCDB · book-ipcn73-74

CCDB · book-ipcn67-71 — MEHRA, P.N., & P. REMANANDAN. 1969. In IOPB chromosome number repoI XXII. Taxon 18: 433-442.

CCDB · book-ipcn73-74 — MEHRA, P.N., & R. REMANANDAN. 1974. Cytolog>cal >nvestigat>ons on th[ Indian Compositae. II. Astereae, Hel~antheae, Helenleae, and Anthemideae. Caryologia 27: 255-289.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type3 000 records

Wild obs. + sensor2 389

Museum / vouchered582

Other29

Origin

Native71

Range

Area of Occupancy AOO6 368 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy34% within 1 km

≤100 m 434≤1 km 217≤10 km 1 235>10 km 47

1 933 georeferenced · 456 without coordinates

Open the mapobservation + sensor2 389

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy75% within 1 km

≤100 m 18≤1 km 213≤10 km 75>10 km 2

308 georeferenced · 274 without coordinates

Open the institutions mapphysical evidence582

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions22 of 44 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Badajoz, ES	76
CICYTEXlocation not on record	71
ISAlocation not on record	68
College of the Atlantic, Museumlocation not on record	48
Córdoba, ES	46
BIO-UNIPIlocation not on record	46
Jaén, ES	33
MAlocation not on record	20
Salamanca, ES	18
BClocation not on record	18
Madrid, ES	12
Museo Achille Folettolocation not on record	11
Barcelona, ES	10
Coimbra, PT	10
València, ES	9
Davis, US	8
Entomological Society of Latvialocation not on record	7
Canadian Department of Agriculturelocation not on record	6
Vitoria, ES	5
Phyletisches Museum Jenalocation not on record	4
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	4
Wlocation not on record	4
CJBGlocation not on record	3
San Jose State University, Museum of Birds and Mammalslocation not on record	3
Granada, ES	2
Universidad del Pais Vasco (UPV/EHU)location not on record	2
LDlocation not on record	2
BRNUlocation not on record	2
Saint Louis, US	2
Kew, GB	1
Nantes Culture Collectionlocation not on record	1
Bern, CH	1
Berlin, DE	1
University of Stellenboschlocation not on record	1
Alicante, ES	1
Paris, FR	1
National Institute for Agricultural and Veterinarian Research, Portugallocation not on record	1
Claremont, US	1
San Sebastián, ES	1
Wuzhou, CN	1
CASlocation not on record	1
Bronx, US	1
Provo, US	1
MeiseBGlocation not on record	1

44 institutions · 565 of 582 vouchered records shown · 16 without an institution code

09Environmental DNA2 detections

Where the DNA of Chamaemelum fuscatum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.1 °C 13.3–15.0

Seasonal swing summer↔winter15.1 °C

Max temp (day)17.9 °C 16.1–19.7

Min temp (night)9.70 °C 9.20–10.3

Precipitation44.1 mm/mo 35.6–52.7

Air humidity57.2 % 53.7–60.7

Moisture balance-50.2 mm/mo -59.4–-41.0

Vapour deficit766 Pa 617–916

Wind speed2.90 m/s 2.20–3.60

Cloud cover41.3 % 38.9–43.7

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Chamaemelum fuscatum

At a glance

Sources12 archives

Size & morphology2

Life cycle & reproduction3

Diet & foraging1

Habitat & environment6

Compound class profile5 classes

Documented compounds80 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type3 000 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions22 of 44 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 000 records