Chamaedorea metallica

O.F.Cook ex H.E.Moore · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Arecales/Arecaceae/Chamaedorea

At a glance

Occurrence records105

Data sources9

Biological traits25

DNA specimens1

eDNA detections1

Sources9 archives

Databases and archives Chamaedorea metallica's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility105 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources25 traits

Occurrence & distributionGBIF105 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceGoaT · NCBI≈687 Mbp

01Narrative

DEFAULTSORT Chamaedorea metallica is a species of flowering plant in the family Arecaceae.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology8

Fruit length11 mm

Fruit length max12 mm

Fruit length min10 mm

Fruit width8.5 mm

Fruit width max9 mm

Fruit width min8 mm

Leaf length max360 mm

Plant height3 m

Life cycle & reproduction3

Life formshrub

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment7

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Fruit colourblack

Growth formtree

Habitat GIFTunderstorey

Woodinesswoody

Other traits6

Dbh max1.5 cm

Defenseno

Leaf spinesno

Plant support typefree-standing

Shoot length max300 cm

Shoot orientationerect

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Chamaedorea metallica has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes3

GenBank sequences4

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMK692491.1 ↗506 bp

ACGT

AATTGCAGAATCCCGTGAACCATCGAGTCTTTGAATGCAAGTTGCGCCCGAGGCCATCCGGCCGAGGGCACGCCTGGCTGGGCGTCACTT …

Chamaedorea metallica voucher SCBG068 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL1★ITS1

plant barcodefungal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Chamaedorea metallica carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈686 588 512 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Chamaedorea metallica0.69 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

08Occurrence & distribution

Record type105 records

Wild obs. + sensor15

Museum / vouchered87

Cultivated / captive3

Range

Area of Occupancy AOO208 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy31% within 1 km

≤100 m 4>10 km 9

13 georeferenced · 2 without coordinates

Open the mapobservation + sensor15

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy97% within 1 km

≤100 m 58≤1 km 3≤10 km 2

63 georeferenced · 24 without coordinates

Open the institutions mapphysical evidence87

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 3 records without

Open the mapnot free-living3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Durango, MX	53
Mexico City, MX	14
Ciudad de México, MX	6
Chapingo, MX	3
Sociedad para el Estudio de los Recursos Bióticos de Oaxaca, A. C.location not on record	2
Centro Cultural Santo Domingolocation not on record	1
Puebla, MX	1
P. Trenellocation not on record	1
Denver, US	1
Miami, US	1
Chongqing Museumlocation not on record	1
Mexico City, MX	1
Auckland, NZ	1
Antiguo Cuscatlán, SV	1

14 institutions · 87 of 87 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Chamaedorea metallica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)