Chamaedorea cataractarum

Mart. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Arecales/Arecaceae/Chamaedorea

At a glance

Occurrence records47

Data sources10

Biological traits23

DNA specimens1

eDNA detections1

Sources10 archives

Databases and archives Chamaedorea cataractarum's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility47 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources23 traits

Occurrence & distributionGBIF47 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 26

01Narrative

نخل گربه(نام علمی: Chamaedorea cataractarum) نام یک گونه از تیره نخل است.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology6

Fruit length10 mm

Fruit width7 mm

Fruit width max8 mm

Fruit width min6 mm

Leaf length max2 000 mm

Plant height2 m

Life cycle & reproduction3

Life formshrub

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment7

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Fruit colourblack

Growth formshrub

Habitat GIFTunderstorey

Woodinesswoody

Other traits6

Dbh max4 cm

Defenseno

Leaf spinesno

Plant support typefree-standing

Shoot length max200 cm

Shoot orientationerect

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Chamaedorea cataractarum has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes3

GenBank sequences5

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMK692487.1 ↗502 bp

ACGT

AATTGCAGAATCCCGTGAACCATCGAGTCTTTGAATGCAAGTTGCGCCCGAGGCCATCCGGCCGAGGGCACGCCTGGCTGGGCGTCACTT …

Chamaedorea cataractarum voucher SCBG019 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL3★ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Chamaedorea cataractarum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 26 n = 13

Ploidypolyploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 261×CCDB · Cave1957

CCDB · Cave1957 — Eichhorn

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=0.999 ↗

08Occurrence & distribution

Record type47 records

Wild obs. + sensor5

Museum / vouchered41

Other1

Range

Area of Occupancy AOO124 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy40% within 1 km

≤100 m 2>10 km 3

5 georeferenced

Open the mapobservation + sensor5

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy96% within 1 km

≤100 m 22≤1 km 1>10 km 1

24 georeferenced · 17 without coordinates

Open the institutions mapphysical evidence41

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mexico City, MX	6
Juriquilla, MX	6
Durango, MX	5
Austin, US	4
Tuxtla Gutiérrez, MX	3
Ann Arbor, US	2
Sociedad para el Estudio de los Recursos Bióticos de Oaxaca, A. C.location not on record	2
Bangkok, TH	2
Universidad Juárez Autónoma de Tabascolocation not on record	2
Saint Louis, US	2
San Francisco, US	1
Tampa, US	1
Miami, US	1
Gujarat Biodiversity Gene Banklocation not on record	1
Auckland, NZ	1
Tuxtla Gutiérrez, MX	1

16 institutions · 40 of 41 vouchered records shown · 1 without an institution code

09Environmental DNA1 detections

Where the DNA of Chamaedorea cataractarum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median32.9 °C 32.9–32.9

Seasonal swing summer↔winter11.9 °C

Max temp (day)39.2 °C

Min temp (night)26.4 °C

Precipitation7.00 mm/mo

Air humidity51.2 %

Moisture balance-227 mm/mo

Vapour deficit2,430 Pa

Wind speed4.00 m/s

Cloud cover9.00 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)