Chamaecrista mimosoides
(L.) Greene · speciesAt a glance
Occurrence records7 000
Data sources12
Biological traits44
DNA specimens20
eDNA detections11
Sources12 archives
Databases and archives Chamaecrista mimosoides's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility7 000 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI11 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics20 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
WikidataWikimedia Foundationstructured facts↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources44 traits
Chemical compositionLOTUS · NPASS16 compounds
Occurrence & distributionGBIF7 000 records
Environmental DNA1 datasets · 5 countries11 detections
DNA & barcodingBOLD · NCBI20 specimens
Genome at a glanceCCDB2n = 16
01Narrative
含羞草决明（学名：）又名假含羞草，俗稱山扁豆、茶豆、黃爪香，为豆科山扁豆属下的一个植物物种。
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPGIFTAusTraitsTRY
Size & morphology13
Fruit length40 mm
Fruit width4 mm
Leaf length3.25 mm
Leaf width0.75 mm
Petiole length0.15 cm
Plant height0.7 m
⚠ sources differ — GIFT: 0.7 m · AusTraits: 1 m
Plant height max1.6 m
Plant height min0.1 m
Seed length3.15 mm
Seed mass2.69 mg
⚠ sources differ — TRY: 2.69 mg · AusTraits: 2.85 mg · GIFT: 2.74 mg
Seed mass max3.36 mg
Seed mass min1.13 mg
Seed width1.9 mm
Life cycle & reproduction13
Dehiscencedehiscent
Dispersal typeself
Flowering endSep
Flowering startMay
Flowering timennnnnyynnnnn
Life formannual, perennial or subshrub
Life spanannual short_lived_perennial
⚠ sources differ — AusTraits: annual short_lived_perennial · GIFT: perennial
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formtherophyte
Reproductive maturity1 years
Resprouting capacityfire_killed
Sex typehermaphrodite
Diet & foraging1
Parasiteindependent
Habitat & environment14
Aquaticterrestrial
Climateseasonally dry tropical
Climberself-supporting
Elevation max1 800 m
Elevation min0 m
Epiphyteterrestrial
Fruit fleshinessdry
Fruit typelegume
Growth formherb
Habitat GIFTroadsides, open, managed
Leaf compoundnesscompound
Leaf shapenarrowly_oblong
Mycorrhiza typearbuscular
Woodinessnon-woody
Physiology & chemistry3
Leaf n38.8 mg/g
Nitrogen fixingnitrogen_fixer
Photosynthetic pathwayC3
03Chemical composition16 compounds
Compounds documented for Chamaecrista mimosoides across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile3 classes
Guaiane sesquiterpenoids10
Anthraquinones and anthrones2
Carbazole alkaloids1
Documented compounds16 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (3aS,5R,6aR,8S,9aR,9bS)-5-hydroxy-3,6,9-trimethylidene-8-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-3a,4,5,6a,7,8,9a,9b-octahydroazuleno[4,5-b]furan-2-one | present | NPASS | |
| (Z)-1-[6-[(3-Acetyl-2,4,6-Trihydroxy-5-Methylphenyl)Methyl]-5,7-Dihydroxy-2,2-Dimethylchromen-8-Yl]-3-Phenylprop-2-En-1-One | present | NPASS | |
| 1,8-Dihydroxy-3-Methyl-4A,9A-Dihydroanthracene-9,10-Dione | present | NPASS | |
| 8-Epicrepiside E | present | NPASS | |
| [(3aR,4R,6aR,8S,9aR,9bR)-3,6,9-trimethylidene-2-oxo-8-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-3a,4,5,6a,7,8,9a,9b-octahydroazuleno[4,5-b]furan-4-yl] (2R)-2-hydroxy-3-methylbutanoate | present | NPASS | |
| [(3aR,4R,6aR,8S,9aR,9bR)-3,6,9-trimethylidene-2-oxo-8-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-3a,4,5,6a,7,8,9a,9b-octahydroazuleno[4,5-b]furan-4-yl] (2R,3S)-2-hydroxy-3-methylpentanoate | present | NPASS | |
| [(3aR,4R,6aR,8S,9aR,9bR)-3,6,9-trimethylidene-2-oxo-8-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-[[2-(4-hydroxyphenyl)acetyl]oxymethyl]oxan-2-yl]oxy-3a,4,5,6a,7,8,9a,9b-octahydroazuleno[4,5-b]furan-4-yl] (2R)-2-hydroxy-3-methylbutanoate | present | NPASS | |
| [(3aR,4R,6aR,8S,9aR,9bR)-3,6,9-trimethylidene-2-oxo-8-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-[[2-(4-hydroxyphenyl)acetyl]oxymethyl]oxan-2-yl]oxy-3a,4,5,6a,7,8,9a,9b-octahydroazuleno[4,5-b]furan-4-yl] (2R,3S)-2-hydroxy-3-methylpentanoate | present | NPASS | |
| [(3aR,4R,6aR,9aR,9bR)-9-methyl-3,6-dimethylidene-2-oxo-8-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-4,5,6a,7,9a,9b-hexahydro-3aH-azuleno[4,5-b]furan-4-yl] (2R,3S)-2-hydroxy-3-methylpentanoate | present | NPASS | |
| Aloe emodin | present | NPASS |
05DNA & barcoding20 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Chamaecrista mimosoides has left across the world's sequence archives.
At a glance
DNA specimens20
Marker genes7
GenBank sequences10
eDNA detections11
Countries5
The DNA barcodea real sequence read deposited for this species
TGCGGAAGGATCATTGTCGAACCTATCTCAAGGACGACCCCGCGAACACGTTGATCTCACGCGGGCGCCGAGGGAAGGAAGGGGAGCGCC …
Chamaecrista mimosoides internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK4★rbcL5★rbcLa★trnL★trnL-F★ITS1trnH-psbA
plant barcodefungal barcodemarker
06Genome at a glanceCCDB
The complete instruction manual Chamaecrista mimosoides carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 16 n = 8
Ploidydiploid inferred
Chromosome records16–162n range16median16mode4records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 164×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 · CCDB · eflora
CCDB · ipcn-api-dl — Bir, S. S. & S. Kumari. 1982. Karyotypic studies in Cassia Linn. from India. Proc. Indian Acad. Sci. 48: 397–404.
CCDB · ipcn-api-dl — Yeh, M. S., H. YUASA & F. Maekawa. 1986. Chromosome numbers in the Leguminosae. Sci. Rep. Res. Inst. Evol. Biol. 3: 57–71.
CCDB · book-ipcn67-71 — KODAMA, A. 1967. Cytological studies on root nodules of some species in Leguminosae II. Bot. Mag. Tokyo 80: 92-99.
CCDB · eflora
n 81×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — George, S. M. & K. V. Bhavanandan. 1994. Studies on chromosome numbers of some south Indian species of Cassia. J. Cytol. Genet. 29(2): 173–176.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type7 000 records
Wild obs. + sensor4 195
Museum / vouchered2 409
Cultivated / captive41
Other355
Origin
Native40
Introduced17
Range
Area of Occupancy AOO15 780 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy82% within 1 km
≤100 m 561≤1 km 87≤10 km 118>10 km 20
786 georeferenced · 3 409 without coordinates
Open the mapobservation + sensor4 195
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy44% within 1 km
≤100 m 135≤1 km 84≤10 km 243>10 km 37
499 georeferenced · 1 910 without coordinates
Open the institutions mapphysical evidence2 409
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy33% within 1 km
≤100 m 1>10 km 2
3 georeferenced · 38 without coordinates
Open the mapnot free-living41
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions38 of 104 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Pretoria, ZA | 299 |
| MeiseBGlocation not on record | 191 |
| Saint Louis, US | 187 |
| Kew, GB | 149 |
| Palmerston, AU | 132 |
| Brisbane, AU | 108 |
| Durban, ZA | 96 |
| LBVlocation not on record | 67 |
| Instituto de Investigação Científica Tropicallocation not on record | 65 |
| Museo Entomologico de Leonlocation not on record | 65 |
| Canberra, AU | 64 |
| WAGlocation not on record | 61 |
| Yaoundé, CM | 59 |
| Kensington, AU | 51 |
| Herbier National du Gabonlocation not on record | 50 |
| Xiamen, CN | 44 |
| Smithfield, AU | 41 |
| Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record | 34 |
| HNBlocation not on record | 32 |
| Adelaide, AU | 27 |
| Mount Annan, AU | 19 |
| Plocation not on record | 19 |
| Université du Lomélocation not on record | 19 |
| University of Stellenboschlocation not on record | 18 |
| Eduardo Mondlane Universitylocation not on record | 18 |
| Taipei, TW | 13 |
| Brussels, BE | 12 |
| LSFlocation not on record | 12 |
| Bronx, US | 12 |
| Paris, FR | 11 |
| BRLUlocation not on record | 11 |
| James Cook Townsvillelocation not on record | 10 |
| LSF/FSA/UAClocation not on record | 9 |
| Clocation not on record | 9 |
| Cape Town, ZA | 8 |
| Uppsala, SE | 7 |
| Nanchong, CN | 6 |
| Haramaya Universitylocation not on record | 6 |
| Xishuangbanna Tropical Botanical Garden, Academia Sinicalocation not on record | 6 |
| TAIElocation not on record | 6 |
| Taipei, TW | 6 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 5 |
| Leiden University Medical Centerlocation not on record | 4 |
| Hobart, AU | 4 |
| John T. Waterhouse Herbariumlocation not on record | 4 |
| Institut de Recherche Agronomique de Guinée (IRAG)location not on record | 4 |
| Edinburgh, GB | 3 |
| Honolulu, US | 3 |
| Arusha, TZ | 3 |
| CJBGlocation not on record | 3 |
| MAlocation not on record | 3 |
| LDlocation not on record | 3 |
| Cambridge, US | 3 |
| Addis Ababa, ET | 3 |
| Elocation not on record | 3 |
| Baroda, IN | 3 |
| EAlocation not on record | 3 |
| BGPAlocation not on record | 3 |
| Berlin, DE | 3 |
| Beijing, CN | 3 |
| Frankfurt am Main | 2 |
| DSMlocation not on record | 2 |
| LISClocation not on record | 2 |
| Moscow State Universitylocation not on record | 2 |
| Centre National de Floristique - Université Félix HOUPHOUËT-BOIGNYlocation not on record | 2 |
| Edward O. Wilson Biodiversity Laboratory, Gorongosa NPlocation not on record | 2 |
| University of Johannesburglocation not on record | 2 |
| Parc Botanique et Zoologique de Tsimbazaza (PBZT)location not on record | 2 |
| Gujarat Biodiversity Gene Banklocation not on record | 2 |
| Botanic Gardenlocation not on record | 2 |
| Instituto Nacional de Pesquisas da Amazônia (INPA)location not on record | 2 |
| Guangxi Agricultural Universitylocation not on record | 2 |
| Forestry Research Institute of Nigerialocation not on record | 2 |
| Mus. Tinro, Vladyvostoklocation not on record | 2 |
| LGlocation not on record | 2 |
| Guilin, CN | 2 |
| Montréal, CA | 2 |
| Armidale, AU | 2 |
| GENTlocation not on record | 1 |
| Nnamdi Azikiwe University Herbarium (NAUH)location not on record | 1 |
| Durham, US | 1 |
| Senckenberg Gesellschaft für Naturforschung: Senckenberg Forschungsinstitut und Naturmuseumlocation not on record | 1 |
| University of Hamburglocation not on record | 1 |
| Mlocation not on record | 1 |
| Auckland, NZ | 1 |
| Centre National des Semences Forestièreslocation not on record | 1 |
| Llocation not on record | 1 |
| Institut de Recherche Agronomique de Guinée (IRAG)location not on record | 1 |
| Centre D'Etude sur les Ressources Végétaleslocation not on record | 1 |
| Fort Worth, US | 1 |
| SNJB's KKHA Arts, SMGL Commerce & SPHJ Science College Chandwad, Dist. Nashik, Maharashtra, India. 423101.location not on record | 1 |
| National Natural History Collectionslocation not on record | 1 |
| Centro de Biotecnologia e Quimica-CEBIQlocation not on record | 1 |
| Université National du Béninlocation not on record | 1 |
| University of Oxfordlocation not on record | 1 |
| Kunming, CN | 1 |
| Istituto Agrario Castelnuovolocation not on record | 1 |
| McWane Science Centerlocation not on record | 1 |
| NGCPR01687location not on record | 1 |
| Glocation not on record | 1 |
| Smithsonian Institution, National Museum of Natural History, United States National Herbariumlocation not on record | 1 |
| MSB-3054location not on record | 1 |
| Institute for Agricultural Research of Mozambiquelocation not on record | 1 |
| University of Liberialocation not on record | 1 |
104 institutions · 2 184 of 2 409 vouchered records shown · 224 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA11 detections
Where the DNA of Chamaecrista mimosoides was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found11
Studies independent surveys1
Countries5
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 11 detections have coordinates
Open the map5 countries0
FloodplainRed soil savanna bushland.
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median23.1 °C 19.5–25.2
Seasonal swing summer↔winter7.50 °C
Max temp (day)29.1 °C 25.0–30.7
Min temp (night)17.6 °C 13.7–20.5
Precipitation23.2 mm/mo 14.0–111
Air humidity55.0 % 46.1–58.2
Moisture balance-78.9 mm/mo -96.9–-54.6
Vapour deficit1,283 Pa 1,014–1,588
Wind speed2.30 m/s 1.90–2.90
Cloud cover13.8 % 7.50–36.9
CHELSA 1981–2010, ~9 km grid, at location & month of 8 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.