Chalciporus rubinellus

(Peck) Singer · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Boletales/Boletaceae/Chalciporus

At a glance

Occurrence records117

Data sources9

Biological traits0

DNA specimens2

eDNA detections2

Sources9 archives

Databases and archives Chalciporus rubinellus's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility117 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome ~0.08 Gbp↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF117 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceGoaT80 Mbp

01Narrative

Chalciporus rubinellus, commonly known as the purple-red bolete, is a bolete fungus of the family Boletaceae. It was first described in 1879 as Boletus rubinellus, and later transferred to the genus Chalciporus in 1973. Genetically it is closely related to Chalciporus amarellus.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Chalciporus rubinellus has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes1

GenBank sequences10

eDNA detections2

Countries2

The DNA barcodea real sequence read deposited for this species

ITSMK286010.1 ↗605 bpUSA · 2017

ACGT

GTTTGATGGGGGTTGTCGCTGGCCTTCGGGCATGTCGCACGCCTCTGTCTTAGTCTCCGTTCCCTTTCTTCTTTTGCGTGGACTCGTTCT …

Chalciporus rubinellus voucher JLF5697 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10

fungal barcode

06Genome at a glanceGoaT

The complete instruction manual Chalciporus rubinellus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size79 560 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

THIS GENOME Chalciporus rubinellus0.08 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

08Occurrence & distribution

Record type117 records

Wild obs. + sensor76

Museum / vouchered41

Range

Area of Occupancy AOO380 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy41% within 1 km

≤100 m 16≤1 km 9≤10 km 25>10 km 11

61 georeferenced · 15 without coordinates

Open the mapobservation + sensor76

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy20% within 1 km

≤100 m 2≤1 km 1≤10 km 9>10 km 3

15 georeferenced · 26 without coordinates

Open the institutions mapphysical evidence41

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bronx, US	10
Université de Montréal Biodiversity Centrelocation not on record	9
Acadia Universitylocation not on record	8
Davis and Elkins Collegelocation not on record	5
Toronto, CA	2
Catholic University of Pekinglocation not on record	1
Durham, US	1
Kew, GB	1
CA	1
Cornell University, Plant Pathology Herbariumlocation not on record	1

10 institutions · 39 of 41 vouchered records shown · 2 without an institution code

09Environmental DNA2 detections

Where the DNA of Chalciporus rubinellus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

Hemlock maple birch

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.5 °C 19.5–19.5

Seasonal swing summer↔winter26.5 °C

Max temp (day)23.7 °C

Min temp (night)16.0 °C

Precipitation127 mm/mo

Air humidity62.9 %

Moisture balance1.60 mm/mo

Vapour deficit840 Pa

Wind speed2.10 m/s

Cloud cover41.0 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)