Chaetothiersia vernalis

B.A.Perry & Pfister · species

image placeholder — illustration coming later

Fungi/Ascomycota/Pezizomycetes/Pezizales/Pyronemataceae/Chaetothiersia

At a glance

Occurrence records17

Data sources8

Biological traits0

DNA specimens4

eDNA detections18

Sources8 archives

Databases and archives Chaetothiersia vernalis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility17 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI18 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF17 records

Environmental DNA4 datasets · 1 countries18 detections

DNA & barcodingBOLD · NCBI4 specimens

01Narrative

Chaetothiersia es un género de hongos de la familia Pyronemataceae. Es monotípico, su única especie Chaetothiersia vernalis es recolectada en las partes altas del norte de Sierra Nevada, California. Se le ha encontrado creciendo en grupos sobre madera y corteza en descomposición de la conífera Abies magnifica.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Chaetothiersia vernalis has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes1

GenBank sequences5

eDNA detections18

Countries1

The DNA barcodea real sequence read deposited for this species

ITSOL629085.1 ↗533 bpUSA · 2021

ACGT

TACTTTTTGTATATACTTGACATAAACCCATTCTGAGTATCCAGCCTGTTGCTTCCGTGATGTATGACATCTGTCACCTTCTTGTCTTTG …

Chaetothiersia vernalis voucher MushroomObserver.org/452507 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS5

fungal barcode

08Occurrence & distribution

Record type17 records

Wild obs. + sensor13

Museum / vouchered4

Range

Area of Occupancy AOO56 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy33% within 1 km

≤100 m 1≤1 km 2≤10 km 4>10 km 2

9 georeferenced · 4 without coordinates

Open the mapobservation + sensor13

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 4 records without

Open the institutions mapphysical evidence4

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
California State University, East Baylocation not on record	4

1 institutions · 4 of 4 vouchered records shown

09Environmental DNA18 detections

Where the DNA of Chaetothiersia vernalis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found18

Studies independent surveys4

Countries1

Verifiable raw sequence linked1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 18 detections have coordinates

Open the map1 country0

Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.2 °C 12.0–24.2

Seasonal swing summer↔winter19.4 °C

Max temp (day)30.2 °C 19.0–30.2

Min temp (night)18.7 °C 4.80–18.7

Precipitation104 mm/mo 28.2–104

Air humidity49.6 % 45.8–49.6

Moisture balance-72.4 mm/mo -128–-72.4

Vapour deficit1,527 Pa 736–1,527

Wind speed1.60 m/s 1.60–1.90

Cloud cover17.9 % 17.9–39.2

CHELSA 1981–2010, ~9 km grid, at location & month of 17 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)