Chaetomium globosum

Kunze · species

image placeholder — illustration coming later

Fungi/Ascomycota/Sordariomycetes/Sordariales/Chaetomiaceae/Chaetomium

At a glance

Occurrence records553

Data sources12

Biological traits0

DNA specimens248

eDNA detections357

Sources12 archives

Databases and archives Chaetomium globosum's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility491 records↗

OBISOcean Biodiversity Information System62 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI357 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics248 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionLOTUS · NPASS399 compounds

Occurrence & distributionGBIF · OBIS553 records

Environmental DNA9 datasets · 20 countries357 detections

DNA & barcodingBOLD · NCBI248 specimens

Genome at a glanceGoaT · NCBI35 Mbp

01Narrative

Chaetomium globosum est une espèce de champignons lignivores de l'ordre des Sordariales qui cause la pourriture molle.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition399 compounds

Compounds documented for Chaetomium globosum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Cytochalasan alkaloids142

Azaphilones115

Flavonols53

Isocoumarins20

3-Decalinoyltetramic acids15

Documented compounds399 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-4-Hydroxypropranolol	present	LOTUS
(+)-neoechinulin A	present	LOTUS
(11S)-9-chloro-14,15-dihydroxy-2-(3-hydroxybutan-2-yl)-11-methyl-6-[(3S)-3-methylpent-1-enyl]-3,5,12-trioxatetracyclo[6.5.2.04,15.011,14]pentadeca-1,6,8-triene-10,13-dione	present	LOTUS
(13)Cytochalasa-5,13,17-triene-1,19,20,23-tetrone, 7-hydroxy-10-(1H-indol-3-yl)-16,18-dimethyl-, (7S,13E,16S,17E)-	present	LOTUS
(1aS,2R,2aR,5S,5aR,6S,6aR)-2a-(4-hydroxybutanoyl)-2-[(1E,5E)-7-hydroxy-4,6-dimethylhepta-1,5-dienyl]-5-(1H-indol-3-ylmethyl)-6,6a-dimethyl-1a,2,4,5,5a,6-hexahydrooxireno[2,3-f]isoindol-3-one	present	LOTUS
(1E,4S,5E,11aR,14S,14aR,15S,15aR,16bR)-14-(1H-indol-3-ylmethyl)-4,6,15,15a-tetramethyl-9,10,14,14a,15,15a,16a,16b-octahydro-3H-cyclotrideca[d]oxireno[f]isoindole-7,8,11,12(4H,13H)-tetrone	present	LOTUS
(1E,4S,5E,8S,11aR,14S,14aR,17S,17aR)-3,3a,6,6a,9,10,15,16-Octahydro-6,14-dihydroxy-3-(1H-indol-3-ylmethyl)-4,5,10,12-tetramethyl-1H-cyclotridec(d)isoindole-1,13,17(2H,14H)-trione	present	LOTUS
(1R,3E,5S,7E,9S,11E,13R,14S,17R,18S)-5,14-dihydroxy-18-(1H-indol-3-ylmethyl)-7,9,15,16-tetramethyl-19-azatricyclo[11.7.0.01,17]icosa-3,7,11,15-tetraene-2,6,20-trione	present	LOTUS
(1R,3E,6R,7Z,9S,11E,13R,14S,15R,16S,17R,18S)-6,14,15-trihydroxy-18-(1H-indol-3-ylmethyl)-7,9,15,16-tetramethyl-19-azatricyclo[11.7.0.01,17]icosa-3,7,11-triene-2,5,20-trione	present	LOTUS
(1R,3E,6R,7Z,9S,11E,13R,14S,15S,16S,17R,18S)-6,14,15-trihydroxy-18-(1H-indol-3-ylmethyl)-7,9,15,16-tetramethyl-19-azatricyclo[11.7.0.01,17]icosa-3,7,11-triene-2,5,20-trione	present	LOTUS

05DNA & barcoding248 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Chaetomium globosum has left across the world's sequence archives.

At a glance

DNA specimens248

Marker genes4

GenBank sequences10

eDNA detections357

Countries31

The DNA barcodea real sequence read deposited for this species

ITSPX148901.1 ↗348 bpIndia · 2025

ACGT

CATTGTGAACGTTACCTATACCGTTGCTTCGGCGGGCGGCCCCGGGGTTTACCCCCCGGGCGCCCCTGGGCCCCACCGCGGGCGCCCGCC …

Chaetomium globosum voucher KFRIMH 837 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10★ITS1★ITS25-8S

fungal barcodemarker

06Genome at a glanceGoaT · NCBI

The complete instruction manual Chaetomium globosum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size35 450 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

THIS GENOME Chaetomium globosum0.04 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

08Occurrence & distribution

Record type553 records

Wild obs. + sensor104

Museum / vouchered437

Cultivated / captive7

Other5

Range

Area of Occupancy AOO1 048 km²

Depth

0–200 m sunlit3

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 15 m · max 15 m · 3 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy15% within 1 km

≤100 m 5≤1 km 8≤10 km 76

89 georeferenced · 15 without coordinates

Open the mapobservation + sensor104

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy25% within 1 km

≤100 m 8≤1 km 14≤10 km 45>10 km 20

87 georeferenced · 350 without coordinates

Open the institutions mapphysical evidence437

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

>10 km 1

1 georeferenced · 6 without coordinates

Open the mapnot free-living7

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions18 of 44 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bernard Price Institute for Palaeontological Researchlocation not on record	30
Bronx, US	30
ILLSlocation not on record	13
DPIlocation not on record	12
Toronto, CA	12
UFPElocation not on record	9
BDBClocation not on record	8
Pullman, US	6
Uppsala, SE	5
Tartu, EE	5
Academy of Sciences of the Republic of Uzbekistanlocation not on record	5
Auckland, NZ	4
Guasave, MX	4
FLASlocation not on record	3
Catholic University of Pekinglocation not on record	3
Université de Montréal Biodiversity Centrelocation not on record	3
Madison, US	3
Copenhagen, DK	3
Annamalai University, Centre of Advanced Study in Marine Biologylocation not on record	3
BJFC, CFCClocation not on record	2
Grupo Actinomicetales Merida Facultad de Medicinalocation not on record	2
PHlocation not on record	2
Stockholm, SE	2
Laboratorio de Ictiologialocation not on record	2
Kew, GB	1
Gijón, ES	1
McWane Science Centerlocation not on record	1
Baton Rouge, US	1
St. Paul, US	1
Uniwersytet Wrocławskilocation not on record	1
University of Athens, Hellenic Collection of Pathogenic Fungilocation not on record	1
Helsinki, FI	1
UAclocation not on record	1
Sydney Medical Schoollocation not on record	1
Brisbane, AU	1
TROMlocation not on record	1
	1
Slovenian Forestry Institutelocation not on record	1
TENN-Flocation not on record	1
Zürich, CH	1
Olocation not on record	1
Museo Entomologico de Leonlocation not on record	1
WU-MYClocation not on record	1
LDlocation not on record	1

44 institutions · 191 of 437 vouchered records shown · 182 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA357 detections

Where the DNA of Chaetomium globosum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found357

Studies independent surveys9

Countries20

Verifiable raw sequence linked6

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 357 detections have coordinates

Open the map20 countries0

Pine(Softwood) dowel buried in soil of a mix…beach soiltissue of plantBirch(Hardwood) dowel buried in soil of a mi…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Measured at samplingin-field

Temperature11.6 °C 11.6–18.2

pH6.84 4.40–8.14

Conductivity1,700 µS/cm 11.0–60,400

Organic carbon0.94 % 0.4–3.82

Water content17.3 % 6.21–34.1

Nitrate-N13.0 mg/kg 2.00–71.0

Phosphorus16.0 mg/kg 3.00–108

Clay15.4 % 7.99–63.6

Sand75.4 % 19.9–89.0

Depth0 m 0–0.2

SoilVertosolVertosolsTenosolKurosolChromosolsTenosols

20 samples with on-site data · median with range · describes the sample, not the organism

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.7 °C 20.0–26.9

Seasonal swing summer↔winter5.50 °C

Max temp (day)27.9 °C 24.4–30.5

Min temp (night)19.2 °C 14.5–25.7

Precipitation46.6 mm/mo 5.00–196

Air humidity57.9 % 51.5–65.1

Moisture balance-67.4 mm/mo

Vapour deficit1,205 Pa 1,036–1,534

Wind speed2.90 m/s

Cloud cover25.6 % 12.8–48.9

CHELSA 1981–2010, ~9 km grid, at location & month of 138 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)