Chaetomium elatum

Kunze · species

image placeholder — illustration coming later

Fungi/Ascomycota/Sordariomycetes/Sordariales/Chaetomiaceae/Chaetomium

At a glance

Occurrence records2 577

Data sources11

Biological traits0

DNA specimens0

eDNA detections1 670

Sources11 archives

Databases and archives Chaetomium elatum's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 938 records↗

OBISOcean Biodiversity Information System639 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 670 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionLOTUS · NPASS43 compounds

Occurrence & distributionGBIF · OBIS2 577 records

Environmental DNA2 datasets · 5 countries1 670 detections

DNA & barcodingNCBIsequences

01Narrative

Chaetomium elatum is a very common and widely distributed saprotrophic fungus of the Chaetomiaceae family of molds which has been found to grow on many different substances all over the world. It was first established by Gustav Kunze after he observed it growing on dead leaves. Its defining features that distinguish it from other Chaetomium species are its extremely coarse terminal hairs and the lemon-shaped morphology of its ascospores. It produces many metabolites with potential biotechnology uses including one with promise against the rice blast disease fungus, Magnaporthe grisea. It shows very little pathogenic ability causing confirmed disease in only a few plant species.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition43 compounds

Compounds documented for Chaetomium elatum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Anthraquinones and anthrones19

Cytochalasan alkaloids7

Cembrane diterpenoids5

Cholestane steroids $ Ergostane steroids5

Indole diketopiperazine alkaloids (L-Trp, L-Ala) $ Thiodiketopiperazine alkaloids3

Documented compounds43 total

Tissue Source Quantified only

Compound	Amount	Source
(1R,3E,7E,9S,11E,13R,14S,16R,17S,18R,19S)-19-(1H-indol-3-ylmethyl)-7,9,16,17-tetramethyl-15-oxa-20-azatetracyclo[11.8.0.01,18.014,16]henicosa-3,7,11-triene-2,5,21-trione	present	LOTUS
(1R,3R,11S,14R)-14-(hydroxymethyl)-3-[3-[[(1R,4R)-4-(hydroxymethyl)-5,7-dimethyl-6,8-dioxo-2,3-dithia-5,7-diazabicyclo[2.2.2]octan-1-yl]methyl]indol-1-yl]-18-methyl-15,16-dithia-10,12,18-triazapentacyclo[12.2.2.01,12.03,11.04,9]octadeca-4,6,8-triene-13,17-dione	present	LOTUS
(1S,2S,3S,5S,7S,9R,10R,11S,12S,15R,16R)-2,16-dimethyl-15-[(E,2R)-6-methyl-5-methylidenehept-3-en-2-yl]-8-oxapentacyclo[9.7.0.02,7.07,9.012,16]octadecane-3,5,10-triol	present	NPASS
(3E,7S,8E,10S,13R)-7-hydroxy-10-(2-hydroxypropan-2-yl)-10-methoxy-3,7,13-trimethylcyclotetradeca-3,8-dien-1-one	present	NPASS
(3E,8S,9E,13R)-10-(2-hydroxypropan-2-yl)-3,8,13-trimethylcyclotetradeca-3,9-diene-1,7-dione	present	NPASS
(3S,3aR,6S,6aR,7E,10S,11E,13R,15E,17aR)-6,13-dihydroxy-3-(1H-indol-3-ylmethyl)-4,5,10,12-tetramethyl-2,3,3a,6,6a,9,10,13-octahydro-1H-cyclotrideca[d]isoindole-1,14,17-trione	present	LOTUS
(3S,8S,9S,10R,13R,14S,17R)-17-[(2R,5S)-6-hydroxy-5,6-dimethylheptan-2-yl]-10,13-dimethyl-2,3,4,7,8,9,11,12,14,15,16,17-dodecahydro-1H-cyclopenta[a]phenanthren-3-ol	present	NPASS
3-(Hydroxymethyl)-10b-(3-{[4-(hydroxymethyl)-5,7-dimethyl-6,8-dioxo-2,3-dithia-5,7-diazabicyclo[2.2.2]oct-1-yl]methyl}-1h-indol-1-yl)-2-methyl-2,3,5a,6,10b,11-hexahydro-3,11a-epidithiopyrazino[1',2':1,5]pyrrolo[2,3-b]indole-1,4-dione	present	LOTUS
Batilol, (R)-	present	NPASS
Chaetoglobinol B	present	LOTUS

05DNA & barcoding10 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Chaetomium elatum has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences10

eDNA detections1 670

Countries8

The DNA barcodea real sequence read deposited for this species

ITSMH860003.1 ↗332 bpGermany

ACGT

GCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCG …

Chaetomium elatum strain CBS 910.70 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10

fungal barcode

08Occurrence & distribution

Record type2 577 records

Wild obs. + sensor126

Museum / vouchered2 447

Other4

Range

Area of Occupancy AOO3 188 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy10% within 1 km

≤100 m 5≤1 km 6≤10 km 102

113 georeferenced · 13 without coordinates

Open the mapobservation + sensor126

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy14% within 1 km

≤100 m 2≤1 km 12≤10 km 63>10 km 22

99 georeferenced · 2 348 without coordinates

Open the institutions mapphysical evidence2 447

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions17 of 32 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bernard Price Institute for Palaeontological Researchlocation not on record	39
Catholic University of Pekinglocation not on record	10
Bronx, US	10
Uppsala, SE	9
BDBClocation not on record	7
Tartu, EE	7
Helsinki, FI	7
Chicago, US	7
Madison, US	6
PHlocation not on record	6
DPIlocation not on record	5
LDlocation not on record	5
Karlsruhe, DE	5
Brown Universitylocation not on record	4
Uniwersytet Wrocławskilocation not on record	4
Toronto, CA	3
Pullman, US	3
Museo Entomologico de Leonlocation not on record	3
Copenhagen, DK	3
Champaign, US	3
Clemson, US	2
FLASlocation not on record	2
McWane Science Centerlocation not on record	2
Kew, GB	2
Salvador, BR	2
Olocation not on record	2
Université de Montréal Biodiversity Centrelocation not on record	1
Grupo Actinomicetales Merida Facultad de Medicinalocation not on record	1
San Sebastián, ES	1
Mlocation not on record	1
Lincoln, US	1
St. Paul, US	1

32 institutions · 164 of 2 447 vouchered records shown · 1 644 without an institution code

09Environmental DNA1 670 detections

Where the DNA of Chaetomium elatum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1 670

Studies independent surveys2

Countries5

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 670 detections have coordinates

Open the map5 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Measured at samplingin-field

Temperature20.0 °C -1.50–40.0

pH6.30 3.60–9.40

Conductivity111 µS/cm 7.00–164,800

Salinity35.2 PSU 8.95–37.0

Dissolved oxygen7.38 mg/L 2.74–11.1

Turbidity0.538 NTU 0–22.2

Organic carbon1.30 % 0.004–16.3

Water content9.84 % 0–88.1

Nitrate-N5.00 mg/kg 0.152–520

Nitrate0.593 µmol/L 0.071–8.80

Phosphorus13.0 mg/kg 2.00–913

Clay14.9 % 0.94–75.9

Sand71.5 % 1.00–99.1

Depth0 m 0–6,015

Coastal waterMarineSoilSedimentPelagicChromosolsFerrosolKandosolTenosolsDermosolRudosol

1 186 samples with on-site data · median with range · describes the sample, not the organism

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.5 °C 12.4–24.5

Seasonal swing summer↔winter9.70 °C

Max temp (day)20.9 °C 15.7–29.2

Min temp (night)13.7 °C 8.00–19.6

Precipitation60.1 mm/mo 8.50–123

Air humidity57.5 % 45.5–61.3

Moisture balance-33.5 mm/mo

Vapour deficit829 Pa 615–1,530

Wind speed4.00 m/s

Cloud cover22.2 % 11.6–30.4

CHELSA 1981–2010, ~9 km grid, at location & month of 1 670 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Chaetomium elatum

At a glance

Sources11 archives

Compound class profile5 classes

Documented compounds43 total

At a glance

Record type2 577 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions17 of 32 geolocated

Signal

Where its DNA was found

How strong is each trace?

Measured at samplingin-field

Modelled climatemodelled

Record type2 577 records