Chaetodon ornatissimus

Cuvier, 1831 · species

image placeholder — illustration coming later

Animalia/Chordata/Perciformes/Chaetodontidae/Chaetodon

At a glance

Occurrence records15 063

Data sources10

Biological traits7

DNA specimens19

eDNA detections18

Sources10 archives

Databases and archives Chaetodon ornatissimus's data was compiled from.

WikipediaWikimedia Foundation11 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility8 933 records↗

OBISOcean Biodiversity Information System6 130 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI18 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics19 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources7 traits

Occurrence & distributionGBIF · OBIS15 063 records

Environmental DNA1 datasets · 5 countries18 detections

DNA & barcodingBOLD19 specimens

01Narrative

The ornate butterflyfish (Chaetodon ornatissimus), or clown butterfyfish is a species of marine ray-finned fish, a butterflyfish in the family Chaetodontidae. The ornate butterflyfish is a close relative of the mailed butterflyfish (C. reticulatus) and the scrawled butterflyfish (C. meyeri).Fessler, Jennifer L., and Mark W. Westneat. "Molecular phylogenetics of the butterflyfishes (Chaetodontidae): taxonomy and biogeography of a global coral reef fish family." Molecular phylogenetics and evolution 45.1 (2007): 50-68. Together they make up the subgenus called “Citharoedus”, but as this name had already been used for the mollusk genus when it was given to the fish, it is not valid. They are probably quite close to the subgenus Corallochaetodon, which contains the Melon Butterflyfish (C. trifasciatus). Like these, they might be separated into Megaprotodon if the genus Chaetodon is split up.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length20 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonereef-associated

Uses & economy1

Commercial importanceminor commercial

Other traits3

Depth max36 m

Depth min0 m

Vulnerability10

05DNA & barcoding19 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Chaetodon ornatissimus has left across the world's sequence archives.

At a glance

DNA specimens19

BINs1

Marker genes3

eDNA detections18

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus17 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 12 variable positions, in barcode order

3Tmostly conserved

106Gmostly conserved

346Amostly conserved

406Tmostly conserved

430Gvariable

478Gvariable

484Amostly conserved

504Tmostly conserved

541Tvariable

565Tmostly conserved

601Gmostly conserved

619Amostly conserved

CCTTTATCTAGTATTTGGTGCCTGAGCCGGAATAGTAGGCACCGCCTTAAGCCTGCTCATCCGAGCAGAGCTCAGCCAACCTGGCTCACT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.39%

Haplotypes3

BIN1

Most divergent pair0.46%

OceaniaAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Chaetodon reticulatussame genus3.1%Chaetodon meyerisame genus6.0%Chaetodon trifasciatussame genus11.8%Chaetodon speculumsame genus12.0%Chaetodon austriacussame genus12.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P16SCYTB

animal barcoderibosomalmitochondrial

07Deep time~2.1 Ma lineage

How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.

At a glance

DNA clock origin2.1 Ma TimeTree

When this lineage existed

How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.

DNA clock origin

08Occurrence & distribution

Record type15 063 records

Wild obs. + sensor14 026

Museum / vouchered947

Other90

Origin

Native12

Range

Area of Occupancy AOO9 380 km²

Depth

0–200 m sunlit5 289

200–1000 m twilight5

1–4 km midnight0

>4 km abyssal0

median 11.3 m · max 520 m · 5 294 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 8 646≤1 km 3 389≤10 km 651>10 km 182

12 868 georeferenced · 1 158 without coordinates

Open the mapobservation + sensor14 026

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy45% within 1 km

≤100 m 23≤1 km 58≤10 km 80>10 km 21

182 georeferenced · 765 without coordinates

Open the institutions mapphysical evidence947

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 24 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	66
CASlocation not on record	47
Sydney, AU	34
Chicago, US	21
Paris, FR	11
Kagoshima University Museumlocation not on record	9
Los Angeles, US	7
Cambridge, US	6
Toronto, CA	6
New Haven, US	6
Western Australian Museumlocation not on record	5
Frankfurt am Main	4
University of California San Diegolocation not on record	4
UWFClocation not on record	3
FishBaselocation not on record	2
Museum and Art Gallery of the Northern Territorylocation not on record	2
Smithsonianlocation not on record	2
DOI/NPS, Salem Maritime National Historic Sitelocation not on record	2
Natick, US	1
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	1
Auckland, NZ	1
Muséum National d'Histoire Naturellelocation not on record	1
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1
North Carolina Museum of Natural Scienceslocation not on record	1

24 institutions · 243 of 947 vouchered records shown · 204 without an institution code

09Environmental DNA18 detections

Where the DNA of Chaetodon ornatissimus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found18

Studies independent surveys1

Countries5

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 18 detections have coordinates

Open the map5 countries0

ocean surface water

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.0 °C 24.6–27.4

Seasonal swing summer↔winter2.10 °C

Max temp (day)26.7 °C 25.2–28.5

Min temp (night)25.2 °C 23.9–26.2

Precipitation153 mm/mo 82.9–265

Air humidity62.3 % 61.5–68.2

Vapour deficit1,213 Pa 1,054–1,333

Cloud cover39.3 % 17.6–47.0

CHELSA 1981–2010, ~9 km grid, at location & month of 14 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Chaetodon ornatissimus

At a glance

Sources10 archives

Size & morphology1

Habitat & environment2

Uses & economy1

Other traits3

At a glance

At a glance

When this lineage existed

Record type15 063 records

Origin

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions11 of 24 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type15 063 records