Chaetodermella luna

(Romell ex D.P.Rogers & H.S.Jacks.) Rauschert · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Gloeophyllales/Gloeophyllaceae/Chaetodermella

At a glance

Occurrence records7 140

Data sources6

Biological traits0

DNA specimens5

eDNA detections6

Sources6 archives

Databases and archives Chaetodermella luna's data was compiled from.

GBIFGlobal Biodiversity Information Facility7 140 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF7 140 records

Environmental DNA2 datasets · 3 countries6 detections

DNA & barcodingBOLD · NCBI5 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Chaetodermella luna has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes1

GenBank sequences9

eDNA detections6

Countries3

The DNA barcodea real sequence read deposited for this species

ITSOL436921.1 ↗613 bp

ACGT

GTAGGTGAACCTGCGGAAGGATCATTAACGAGTAAACAAGGGGAGTTGTAGCTGGCCGCAAGGATGTGCACGCTCTCCGCTCAATCCAAC …

Chaetodermella luna voucher DK16_38 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS9

fungal barcode

08Occurrence & distribution

Record type7 140 records

Wild obs. + sensor6 618

Museum / vouchered522

Range

Area of Occupancy AOO12 904 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy99% within 1 km

≤100 m 6 135≤1 km 117≤10 km 37>10 km 1

6 290 georeferenced · 328 without coordinates

Open the mapobservation + sensor6 618

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy86% within 1 km

≤100 m 193≤1 km 69≤10 km 38>10 km 4

304 georeferenced · 218 without coordinates

Open the institutions mapphysical evidence522

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 22 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Olocation not on record	169
Helsinki, FI	151
Metsähallituslocation not on record	36
SLU Artdatabankenlocation not on record	29
Copenhagen, DK	25
BioFokuslocation not on record	14
Oulu, FI	13
CA	13
Trondheim, NO	10
Kuopio, FI	6
TROMlocation not on record	4
Göteborg, SE	4
University of Oslo, Natural History Museumlocation not on record	3
Stockholm, SE	2
Uppsala, SE	2
nsnflocation not on record	2
Trondheim, NO	1
Rovaniemi, FI	1
Tartu, EE	1
Görlitz, DE	1
California State University, East Baylocation not on record	1
Umeå Universitylocation not on record	1

22 institutions · 489 of 522 vouchered records shown · 33 without an institution code

09Environmental DNA6 detections

Where the DNA of Chaetodermella luna was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys2

Countries3

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map3 countries0

ForestNA T4 Skogsmark Blokkrik furuskog. Pa grove …

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median6.50 °C 1.30–10.7

Seasonal swing summer↔winter21.1 °C

Max temp (day)10.0 °C 2.40–14.4

Min temp (night)2.80 °C -2.20–6.70

Precipitation98.1 mm/mo 62.9–149

Air humidity64.5 % 57.8–69.7

Moisture balance76.3 mm/mo

Vapour deficit356 Pa 213–530

Wind speed3.10 m/s

Cloud cover52.7 % 48.0–68.5

CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Chaetodermella luna

At a glance

Sources6 archives

At a glance

Record type7 140 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions13 of 22 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type7 140 records