Ceuthophilus hesperus

Hubbell, 1936 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Orthoptera/Rhaphidophoridae/Ceuthophilus

At a glance

Occurrence records190

Data sources7

Biological traits0

DNA specimens23

eDNA detections11

Sources7 archives

Databases and archives Ceuthophilus hesperus's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility190 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI11 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics23 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF190 records

Environmental DNA1 datasets · 0 countries11 detections

DNA & barcodingBOLD23 specimens

01Narrative

Ceuthophilus hesperus, the San Diego camel cricket, is a species of camel cricket in the family Rhaphidophoridae. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding23 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ceuthophilus hesperus has left across the world's sequence archives.

At a glance

DNA specimens23

BINs1

Marker genes2

eDNA detections11

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P675 bp consensus12 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 23 variable positions, in barcode order

9Amostly conserved

48Amostly conserved

99Cmostly conserved

162Tmostly conserved

192Cmostly conserved

201Tmostly conserved

240Tmostly conserved

258Cmostly conserved

325Gmostly conserved

327Cmostly conserved

351Cmostly conserved

363Tmostly conserved

366Gmostly conserved

408Tmostly conserved

527Cmostly conserved

537Amostly conserved

564Cmostly conserved

570Tmostly conserved

573Cmostly conserved

624Tmostly conserved

636Gmostly conserved

645Amostly conserved

675Tmostly conserved

GATATTGGAACACTTTACTTTATCTTTGGAGCATGGGCCGGAATAGTAGGTACATCTTTAAGTCTCTTAATTCGTGCTGAATTAGGACAA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.64%

Haplotypes7

BIN1

Most divergent pair1.0%

Other

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Ceuthophilus brevipessame genus11.6%Ceuthophilus agassiziisame genus12.6%Udeopsylla robustasame family12.6%Anopheles peditaeniatussame order16.6%Evergestis columbialissame order17.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

08Occurrence & distribution

Record type190 records

Wild obs. + sensor170

Museum / vouchered20

Range

Area of Occupancy AOO428 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 82≤1 km 16≤10 km 3>10 km 12

113 georeferenced · 57 without coordinates

Open the mapobservation + sensor170

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 20 records without

Open the institutions mapphysical evidence20

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
San Diego, US	19
New Haven, US	1

2 institutions · 20 of 20 vouchered records shown

09Environmental DNA11 detections

Where the DNA of Ceuthophilus hesperus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found11

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 11 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)