Ceropegia jainii — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Gentianales/Apocynaceae/Ceropegia

At a glance

Occurrence records46

Data sources8

Biological traits3

DNA specimens0

eDNA detections0

Sources8 archives

Databases and archives Ceropegia jainii's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility46 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources3 traits

Occurrence & distributionGBIF46 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 22

01Narrative

Ceropegia jainii is a species of flowering plant in the family Apocynaceae.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRY

Life cycle & reproduction1

Life formtuberous geophyte

Habitat & environment1

Climateseasonally dry tropical

Other traits1

Plant support typefree-standing

05DNA & barcoding3 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ceropegia jainii has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMT056083.1 ↗631 bpIndia

ACGT

AAAAAACAAAAATGACCTGAGAATATGTTCAATAACATGCATCGGGTGTGAGGGTAAAATCTCTTTGTCCGTTGCTCTTTGTCCAACCAA …

Ceropegia jainii isolate C22 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS3

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Ceropegia jainii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 221×CCDB · iapt

CCDB · iapt — IAPT/IOPB Chromosome Data 14

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type46 records

Wild obs. + sensor46

Range

Area of Occupancy AOO36 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy63% within 1 km

≤100 m 2≤1 km 24≤10 km 12>10 km 3

41 georeferenced · 5 without coordinates

Open the mapobservation + sensor46

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.