Ceropegia fusca

Bolle · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Gentianales/Apocynaceae/Ceropegia

At a glance

Occurrence records505

Data sources12

Biological traits20

DNA specimens1

eDNA detections1

Sources12 archives

Databases and archives Ceropegia fusca's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility505 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources20 traits

Chemical compositionNPASS2 compounds

Occurrence & distributionGBIF505 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB · GoaT421 Mbp

01Narrative

Ceropegia fusca is a flowering plant in the genus Ceropegia (Apocynaceae). It is endemic to the Canary Islands, where it grows on Tenerife (especially the Macizo de Anaga area), Gran Canaria, and La Palma in the Tabaibal-Cardonal zone at up to about 600 m altitude.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFT

Size & morphology7

Fruit length max150 mm

Fruit length min100 mm

Leaf length max50 mm

Leaf width max4 mm

Leaf width min2 mm

Plant height max1 m

Plant height min0.3 m

Life cycle & reproduction5

Flower colourbrown

Flowering endMay

Flowering startFeb

Life formsucculent subshrub or shrub

Life spanperennial

Habitat & environment7

Climatesubtropical

Elevation max600 m

Elevation min100 m

Fruit typefollicle

Growth formshrub

Succulenceyes

Woodinessnon-woody

Other traits1

Shoot orientationerect

03Chemical composition2 compounds

Compounds documented for Ceropegia fusca across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Fatty alcohols1

Documented compounds2 total

Tissue Source Quantified only

Compound	Class	Amount	Source
(R)-oct-1-en-3-ol		present	NPASS
APFBWMGEGSELQP-SLGIHZDVSA-N		present	NPASS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ceropegia fusca has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes3

GenBank sequences5

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKT795413.1 ↗661 bp

ACGT

GAACCTGCGGAAGGATCATTGTTAAATCACAAAAAACAAAAATGACCTGAGAATATGTTCAATAACATGCATCGGGTGTGAGGGTAAAAG …

Ceropegia fusca voucher Malir 001 (BOL) internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL2★ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Ceropegia fusca carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size420 540 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Ceropegia fusca0.42 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidy2× diploid · measured

Chromosome records22–222n range22median22mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 224×GoaT · Kew Plant DNA C-values Database · CCDB · ipcn-api-dl · CCDB · book-ipcn72 +1

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · ipcn-api-dl — Albers, F., M. Austmann & U. Meve. 1990. IOPB chromosome data 2. Int. Organ. Pl. Biosyst. Newslett. (Zurich) 15: 11.

CCDB · book-ipcn72 — BRAMWELL, D., C.J. HUMPHRIES, B.G. MURRAY, & S.J. OWENS. 1972. Chromosome studies in the flora of Macaronesia. Bot. Notiser 125: 139-152.

CCDB · kew — Suda J, Kyncl T, Freiova R. 2003. Nuclear DNA amounts in Macaronesian angiosperms. Annals of Botany 92: 153-164.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type505 records

Wild obs. + sensor495

Museum / vouchered9

Cultivated / captive1

Range

Area of Occupancy AOO584 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy73% within 1 km

≤100 m 237≤1 km 65≤10 km 96>10 km 18

416 georeferenced · 79 without coordinates

Open the mapobservation + sensor495

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤1 km 1≤10 km 1

2 georeferenced · 7 without coordinates

Open the institutions mapphysical evidence9

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
LDlocation not on record	3
Alicante, ES	1
MAlocation not on record	1
Córdoba, AR	1
Santa Barbara, US	1

5 institutions · 7 of 9 vouchered records shown · 2 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Ceropegia fusca was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)