Ceriops decandra

(Griff.) Ding Hou · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malpighiales/Rhizophoraceae/Ceriops

At a glance

Occurrence records155

Data sources14

Biological traits17

DNA specimens21

eDNA detections20

Sources14 archives

Databases and archives Ceriops decandra's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility155 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI20 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics21 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources17 traits

Chemical compositionLOTUS · NPASS98 compounds

Occurrence & distributionGBIF155 records

Environmental DNA1 datasets · 1 countries20 detections

DNA & barcodingBOLD · NCBI21 specimens

Genome at a glanceCCDB · GoaT · NCBI≈224 Mbp

01Narrative

Ceriops decandra is a mangrove plant of tropical Asia in the family Rhizophoraceae. The specific epithet ' is from the Greek meaning "ten male", referring to the flower having ten stamens.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology4

Plant height max15 m

Seed mass2 624 mg

Seed mass max2 740 mg

Seed mass min2 740 mg

Life cycle & reproduction4

Deciduousnessevergreen

Dispersal typewater

Life formtree

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Growth formtree

Woodinesswoody

Physiology & chemistry2

Photosynthetic pathwayC3

Wood density770 mg/cm³

03Chemical composition98 compounds

Compounds documented for Ceriops decandra across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Lupane triterpenoids20

Kaurane and Phyllocladane diterpenoids $ Tetracyclic diterpenoids6

Erythroxylane diterpenoids5

Guaiane sesquiterpenoids5

Oleanane triterpenoids4

Documented compounds98 total

Tissue Source Quantified only

Compound	Amount	Source
((1R,3aR,5aR,5bR,7aR,9S,11aR,11bR,13aR,13bR)-3a,5a,5b,8,8,11a-hexamethyl-1-prop-1-en-2-yl-1,2,3,4,5,6,7,7a,9,10,11,11b,12,13,13a,13b-hexadecahydrocyclopenta(a)chrysen-9-yl) (E)-3-(3,4-dihydroxyphenyl)prop-2-enoate	present	LOTUS
(+)-Betulonic acid	present	NPASS
(+)-Ursolic Acid	present	LOTUS
(1R)-1-[(2S,4aR,4bR,8aR)-2,4b,8,8-tetramethyl-4,4a,5,6,7,8a,9,10-octahydro-3H-phenanthren-2-yl]ethane-1,2-diol	present	LOTUS
(1R)-1-[(2S,4aS,4bR,8aS,10aS)-2,4a,8a-trimethyl-8-methylidene-1,3,4,4b,5,6,7,9,10,10a-decahydrophenanthren-2-yl]ethane-1,2-diol	present	LOTUS
(1R,4e,6s,7r,10e,14r)-6-hydroxy-10,14-dimethyl-7-(1-methylethenyl)-15-oxabicyclo[12.1.0]pentadeca-4,10-diene-4-methanol	present	NPASS
(1R,4R,8S,9R,10S,13R,14R)-14-(hydroxymethyl)-5,5,9,13-tetramethyl-15-oxatetracyclo[11.2.1.01,10.04,9]hexadecan-8-ol	present	LOTUS
(1R,4S,5R,9S,10R,13S)-5,9,13-trimethyl-14-oxotetracyclo[11.2.1.01,10.04,9]hexadecane-5-carbaldehyde	present	LOTUS
(1R,4S,8R,9S,10R,13R,14R)-14-(hydroxymethyl)-5,5,9,13-tetramethyl-15-oxatetracyclo[11.2.1.01,10.04,9]hexadecan-8-ol	present	LOTUS
(1S)-1-[(2S,4aS,4bR,8aS,10aS)-2,4a,8,8a-tetramethyl-3,4,4b,5,6,9,10,10a-octahydro-1H-phenanthren-2-yl]ethane-1,2-diol	present	LOTUS

05DNA & barcoding21 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ceriops decandra has left across the world's sequence archives.

At a glance

DNA specimens21

Marker genes4

GenBank sequences10

eDNA detections20

Countries1

The DNA barcodea real sequence read deposited for this species

ITSPQ270698.1 ↗280 bp

ACGT

CAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCTTCTGGCCGAGGGCACGTCTGCCTGGGTGTCACTCGACAT …

Ceriops decandra isolate Rn_Cd5 5.8S ribosomal RNA gene and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcL★ITS10★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT · NCBI

The complete instruction manual Ceriops decandra carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈224 289 561 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

THIS GENOME Ceriops decandra0.22 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 36 n = 18

Ploidydiploid inferred

Chromosome records36–362n range36median36mode5records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 365×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 · CCDB · book-indian_vol1 +1

CCDB · ipcn-api-dl — Subramanian, D. 1988. Cytological studies of some mangrove flora of Tamilnadu. Cytologia 53: 87–92.

CCDB · ipcn-api-dl — Das, A. B., U. C. Basak & P. Das. 1995. Karyotype diversity and genomic variability in some Indian tree mangroves. Caryologia 48(3–4): 319–328.

CCDB · book-ipcn67-71 — SIDHU, S.S. 1968. Further studies on the cytology of mangrove species of India. Caryologia 21: 353-357.

CCDB · book-indian_vol1 — Sidhu, S.S. 1968 Subramanian, D. 1980c

CCDB · book-fedorov — Raghavan R S., Arora 1958 .

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=0.944 ↗

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

Completeness96.3% BUSCO

08Occurrence & distribution

Record type155 records

Wild obs. + sensor31

Museum / vouchered114

Other10

Range

Area of Occupancy AOO380 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

≤10 km 2>10 km 14

16 georeferenced · 15 without coordinates

Open the mapobservation + sensor31

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy52% within 1 km

≤1 km 29≤10 km 26>10 km 1

56 georeferenced · 58 without coordinates

Open the institutions mapphysical evidence114

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pondicherry, IN	27
Canberra, AU	17
South Kensington, GB	9
Fort Worth, US	3
Museo Entomologico de Leonlocation not on record	2
Smithfield, AU	2
Annamalai University, Faculty of Marine Scienceslocation not on record	1
Taipei, TW	1
Hobart, AU	1
Dehra Dun, IN	1

10 institutions · 64 of 114 vouchered records shown · 48 without an institution code

09Environmental DNA20 detections

Where the DNA of Ceriops decandra was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found20

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 20 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.1 °C 25.1–25.1

Seasonal swing summer↔winter16.5 °C

Max temp (day)30.5 °C

Min temp (night)19.3 °C

Precipitation109 mm/mo

Air humidity52.0 %

Moisture balance-17.8 mm/mo

Vapour deficit1,616 Pa

Wind speed1.80 m/s

Cloud cover25.2 %

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)