Cereus mirabella — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Caryophyllales/Cactaceae/Cereus

At a glance

Occurrence records67

Data sources7

Biological traits9

DNA specimens0

eDNA detections0

Sources7 archives

Databases and archives Cereus mirabella's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility67 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources9 traits

Occurrence & distributionGBIF67 records

DNA & barcodingNCBIsequences

01Narrative

Mirabella minensis, synonym Cereus mirabella, is a species of plant in the family Cactaceae. It is endemic to Brazil. Its natural habitat is dry savanna. It is threatened by habitat loss.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTTRY

Life cycle & reproduction1

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climberobligatory

Epiphyte detailedterrestrial

Growth form detailedshrub

Habitat GIFTCaatinga (stricto sensu), Carrasco, Cerrado (lato sensu)

Woodinesswoody

Other traits1

Plant support typefree-standing

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cereus mirabella has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

The DNA barcodea real sequence read deposited for this species

matKKR998174.1 ↗1 221 bp

ACGT

AAATAATCCAAAAAACTCCCTGCTTTTTTTTAGTTTTCGGTCTAATTTGAAATGGAAGAATTCCAAAGATATATAGAACTAGATAGGTCT …

Cereus mirabella isolate S77A19GK trnK gene, partial sequence; and maturase K (matK) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

matK1

plant barcode

08Occurrence & distribution

Record type67 records

Wild obs. + sensor13

Museum / vouchered50

Other4

Origin

Native26

Range

Area of Occupancy AOO184 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 13

13 georeferenced

Open the mapobservation + sensor13

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 50 records without

Open the institutions mapphysical evidence50

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kew, GB	12
UFSCarlocation not on record	12
UnBlocation not on record	7
Brasília, BR	7
JBRJlocation not on record	4
USP-IBlocation not on record	2
Laboratorio de Ictiologialocation not on record	2
Cruz das Almas, BR	1
Ilhéus, BR	1
CEPLAClocation not on record	1
Chaguaramas, TT	1

11 institutions · 50 of 50 vouchered records shown