Cereus hildmannianus

K.Schum. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Caryophyllales/Cactaceae/Cereus

At a glance

Occurrence records769

Data sources13

Biological traits27

DNA specimens2

eDNA detections3

Sources13 archives

Databases and archives Cereus hildmannianus's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility769 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

giftgenome & karyotype

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources27 traits

Chemical compositionLOTUS1 compounds

Occurrence & distributionGBIF769 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB · GIFT2n = 22

01Narrative

Cereus hildmannianus is a species of cactus from southern South America. Its distribution is uncertain but probably includes Brazil, Paraguay, Uruguay and Argentina., pp. 144–145

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTAusTraitsTRY

Size & morphology6

Fruit length max75 mm

Fruit length min50 mm

Leaf length max40 mm

Leaf length min10 mm

Plant height7 m

⚠ sources differ — GIFT: 7 m · TRY: 4.61 m

Plant height max15 m

Life cycle & reproduction6

Deciduousnessevergreen

Dehiscenceindehiscent

Life formsucculent tree

Life spanperennial

Pollination modebiotic

Pollination syndromeinsect

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Elevation max1 000 m

Elevation min0 m

Epiphyteterrestrial

Fruit typeberry

Growth formherb

⚠ sources differ — GIFT: herb · AusTraits: shrub

Woodinesswoody

Physiology & chemistry4

Leaf dry-matter content (LDMC)170 mg/g

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayCAM

Specific leaf area (SLA)2.05 mm²/mg

Other traits1

Plant support typefree-standing

03Chemical composition1 compounds

Compounds documented for Cereus hildmannianus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Monosaccharides1

Documented compounds1 total

Tissue Source Quantified only

Compound	Class	Amount	Source
(2R)-3-[(2S,3S,4R)-3,4-dihydroxy-5-oxooxolan-2-yl]-2-hydroxypropanoic acid		present	LOTUS

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cereus hildmannianus has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes3

GenBank sequences9

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSOP188786.1 ↗433 bp

ACGT

CGGGGGGCAACCCCCGGCGCAGCAACGAAACCCCGGCGCGAACCGCGCCAAGGAACACGAACTCATGGCGTGCCAGCCTGCGCCTGGTCC …

Cereus hildmannianus isolate S90V3 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★matK8★ITS1

animal barcodeplant barcodefungal barcode

06Genome at a glanceCCDB · GIFT

The complete instruction manual Cereus hildmannianus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidydiploid inferred

Chromosome records22–222n range22median22mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 223×CCDB · book-ipcn73-74 · CCDB · book-fedorov · GIFT · GIFT (floras)

CCDB · book-ipcn73-74 — ARP, G.K. 1973. In IOPB chromosome number reports XXXIX. Taxon 22: 115-118.

CCDB · book-fedorov — Katagiri 1953

GIFT · GIFT (floras)

n 112×CCDB · ipcn-api-dl · CCDB · book-ipcn75-78

CCDB · ipcn-api-dl — DI FULVIO, T. E. 1977a. El numero cromosomico de Condalia (Rhamnaceae). Kurtziana 10: 249.

CCDB · book-ipcn75-78 — Di Fulvio 1977a

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type769 records

Wild obs. + sensor666

Museum / vouchered83

Cultivated / captive1

Other19

Origin

Native35

Introduced4

Range

Area of Occupancy AOO2 048 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy81% within 1 km

≤100 m 267≤1 km 119≤10 km 64>10 km 27

477 georeferenced · 189 without coordinates

Open the mapobservation + sensor666

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy73% within 1 km

≤1 km 11≤10 km 3>10 km 1

15 georeferenced · 68 without coordinates

Open the institutions mapphysical evidence83

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 35 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
JBRJlocation not on record	7
San Jose State University, Museum of Birds and Mammalslocation not on record	7
Museo Entomologico de Leonlocation not on record	6
Adelaide, AU	5
Universidade Federale do Rio Grande do Sullocation not on record	5
Blumenau, BR	5
Ivano-Frankivsk, UA	4
UFSCarlocation not on record	4
Cascavel, BR	3
Kew, GB	3
Campo Mourão, BR	2
Maringá, BR	2
URCAlocation not on record	2
UNESP-RClocation not on record	2
BDBClocation not on record	2
UTFPR-CPlocation not on record	2
Palmerston, AU	2
FUVATESlocation not on record	2
Foz do Iguaçu, BR	2
UNESP, Campus São José Rio Prêtolocation not on record	1
Mount Annan, AU	1
Feira de Santana, BR	1
UFPRlocation not on record	1
UNISANTAlocation not on record	1
UNICAMPlocation not on record	1
INMAlocation not on record	1
ASUlocation not on record	1
Laboratorio de Ictiologialocation not on record	1
UFMSlocation not on record	1
UNESP-FCAlocation not on record	1
Institut fur Allgemeine Mikrobiologielocation not on record	1
Phoenix, US	1
PUC-RSlocation not on record	1
Universidade Federal do Rio Grande do Nortelocation not on record	1
Lake Charles, US	1

35 institutions · 83 of 83 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA3 detections

Where the DNA of Cereus hildmannianus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.1 °C 25.1–25.1

Seasonal swing summer↔winter2.20 °C

Max temp (day)30.2 °C

Min temp (night)21.3 °C

Precipitation164 mm/mo

Air humidity64.0 %

Moisture balance32.9 mm/mo

Vapour deficit1,154 Pa

Wind speed1.10 m/s

Cloud cover45.9 %

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)