Cercospora zebrina

Pass. · species

image placeholder — illustration coming later

Fungi/Ascomycota/Dothideomycetes/Mycosphaerellales/Mycosphaerellaceae/Cercospora

At a glance

Occurrence records289

Data sources9

Biological traits0

DNA specimens16

eDNA detections16

Sources9 archives

Databases and archives Cercospora zebrina's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility289 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI16 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics16 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF289 records

Environmental DNA1 datasets · 4 countries16 detections

DNA & barcodingBOLD · NCBI16 specimens

01Narrative

Cercospora zebrina is a fungal plant pathogen.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding16 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cercospora zebrina has left across the world's sequence archives.

At a glance

DNA specimens16

Marker genes1

GenBank sequences10

eDNA detections16

Countries5

The DNA barcodea real sequence read deposited for this species

ITSMT804384.1 ↗470 bpIran

ACGT

GATCATTACTGAGTGAGGGCCTTCGGGCTCGACCTCCAACCCTTTGTGAACACAACTTGTTGCTTCGGGGGCGACCCTGCCGTTTCGACG …

Cercospora zebrina isolate IRAN_3967C internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10

fungal barcode

08Occurrence & distribution

Record type289 records

Wild obs. + sensor19

Museum / vouchered254

Cultivated / captive5

Other11

Range

Area of Occupancy AOO684 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy28% within 1 km

≤100 m 5≤10 km 12>10 km 1

18 georeferenced · 1 without coordinates

Open the mapobservation + sensor19

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy7% within 1 km

≤1 km 14≤10 km 143>10 km 40

197 georeferenced · 57 without coordinates

Open the institutions mapphysical evidence254

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 5 records without

Open the mapnot free-living5

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 22 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
ILLSlocation not on record	76
Bernard Price Institute for Palaeontological Researchlocation not on record	51
Madison, US	31
Catholic University of Pekinglocation not on record	20
DPIlocation not on record	14
Auckland, NZ	11
Pullman, US	6
Grupo Actinomicetales Merida Facultad de Medicinalocation not on record	6
Champaign, US	5
Bronx, US	3
Chicago, US	3
Toronto, CA	3
PHlocation not on record	3
TENN-Flocation not on record	2
Brown Universitylocation not on record	2
Kensington, AU	1
Hirosaki Universitylocation not on record	1
Museo Entomologico de Leonlocation not on record	1
Lincoln, US	1
Karlsruhe, DE	1
Canberra, AU	1
Clemson, US	1

22 institutions · 243 of 254 vouchered records shown · 4 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA16 detections

Where the DNA of Cercospora zebrina was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found16

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 16 detections have coordinates

Open the map4 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median5.70 °C 5.70–17.5

Seasonal swing summer↔winter12.3 °C

Max temp (day)9.20 °C 9.20–22.4

Min temp (night)1.40 °C 1.40–11.1

Precipitation130 mm/mo 45.5–130

Air humidity62.6 % 50.7–62.6

Moisture balance54.3 mm/mo -62.0–54.3

Vapour deficit357 Pa 357–1,245

Wind speed5.90 m/s 2.50–5.90

Cloud cover38.9 % 32.0–41.0

CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)