Cercospora kikuchii

(Tak.Matsumoto & Tomoy.) M.W.Gardner · species

image placeholder — illustration coming later

Fungi/Ascomycota/Dothideomycetes/Mycosphaerellales/Mycosphaerellaceae/Cercospora

At a glance

Occurrence records276

Data sources9

Biological traits0

DNA specimens26

eDNA detections28

Sources9 archives

Databases and archives Cercospora kikuchii's data was compiled from.

GBIFGlobal Biodiversity Information Facility276 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI28 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics26 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Chemical compositionLOTUS · NPASS24 compounds

Occurrence & distributionGBIF276 records

Environmental DNA3 datasets · 2 countries28 detections

DNA & barcodingBOLD · NCBI26 specimens

Genome at a glanceGoaT · NCBI28 Mbp

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition24 compounds

Compounds documented for Cercospora kikuchii across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Anthraquinones and anthrones8

Ursane and Taraxastane triterpenoids5

Oleanane triterpenoids3

Unsaturated fatty acids2

Simple coumarins1

Documented compounds24 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Ursolic Acid	present	NPASS
(1S,2R,4aS,6aR,6aS,6bR,8aR,10S,12aR,14bS)-10-formyloxy-1,2,6a,6b,9,9,12a-heptamethyl-2,3,4,5,6,6a,7,8,8a,10,11,12,13,14b-tetradecahydro-1H-picene-4a-carboxylic acid	present	NPASS
(1S,2S,4S,5R,6S,11R,14R,15S,18S,21R,22S,23R)-6,10,10,14,15,21,22-heptamethyl-3,24-dioxaheptacyclo[16.5.2.01,15.02,4.05,14.06,11.018,23]pentacosane-9,25-dione	present	NPASS
(1S,2S,4S,5R,6S,9S,11R,14R,15S,18S,21R,22S,23R)-9-hydroxy-6,10,10,14,15,21,22-heptamethyl-3,24-dioxaheptacyclo[16.5.2.01,15.02,4.05,14.06,11.018,23]pentacosan-25-one	present	NPASS
(4aS,6aR,6aR,6bR,8aR,10S,12aR,14bS)-10-hydroxy-6a-[[(Z)-3-(4-hydroxyphenyl)prop-2-enoyl]oxymethyl]-2,2,6b,9,9,12a-hexamethyl-1,3,4,5,6,6a,7,8,8a,10,11,12,13,14b-tetradecahydropicene-4a-carboxylic acid	present	NPASS
1,2-Dihydroxy-6-methylanthracene-9,10-dione	present	NPASS
2,3-Di(nonadec-18-en-4-ynoyloxy)propyl nonadec-18-en-4-ynoate	present	NPASS
3\|A-Hydroxyurs-11-en-28,13\|A-olide	present	NPASS
Anthragallol	present	NPASS
Anthraquinone, 2-benzyl-1,3-dihydroxy-	present	NPASS

05DNA & barcoding26 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cercospora kikuchii has left across the world's sequence archives.

At a glance

DNA specimens26

Marker genes1

GenBank sequences10

eDNA detections28

Countries5

The DNA barcodea real sequence read deposited for this species

ITSPX569328.1 ↗406 bpBrazil · 2022

ACGT

TCGACGGCGAGCGCCCCCGGAGGCCTTCAAACACTGCATCTTTGCGTCGGAGTTTAAGTAAATTAAACAAAACTTTCAACAACGGATCTC …

Cercospora kikuchii isolate MEMR574 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10

fungal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Cercospora kikuchii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size28 400 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

THIS GENOME Cercospora kikuchii0.03 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

Completeness96.3% BUSCO

08Occurrence & distribution

Record type276 records

Wild obs. + sensor3

Museum / vouchered273

Range

Area of Occupancy AOO176 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 2

2 georeferenced · 1 without coordinates

Open the mapobservation + sensor3

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy15% within 1 km

≤100 m 2≤10 km 9>10 km 2

13 georeferenced · 260 without coordinates

Open the institutions mapphysical evidence273

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
Bernard Price Institute for Palaeontological Researchlocation not on record	8
ILLSlocation not on record	3
TNMlocation not on record	2
Catholic University of Pekinglocation not on record	2

4 institutions · 15 of 273 vouchered records shown · 255 without an institution code

09Environmental DNA28 detections

Where the DNA of Cercospora kikuchii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found28

Studies independent surveys3

Countries2

Verifiable raw sequence linked2

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 28 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median7.40 °C 7.40–19.8

Seasonal swing summer↔winter25.4 °C

Max temp (day)9.60 °C 9.60–24.2

Min temp (night)3.00 °C 3.00–14.4

Precipitation344 mm/mo 180–344

Air humidity64.9 % 55.9–64.9

Moisture balance263 mm/mo 66.3–263

Vapour deficit428 Pa 428–1,260

Wind speed2.90 m/s 2.10–2.90

Cloud cover44.6 % 31.0–44.6

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)