Cercospora delaireae — The Life Data

Fungi/Ascomycota/Dothideomycetes/Mycosphaerellales/Mycosphaerellaceae/Cercospora

At a glance

Occurrence records15

Data sources6

Biological traits0

DNA specimens4

eDNA detections17

Sources6 archives

Databases and archives Cercospora delaireae's data was compiled from.

GBIFGlobal Biodiversity Information Facility15 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI17 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF15 records

Environmental DNA3 datasets · 12 countries17 detections

DNA & barcodingBOLD · NCBI4 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cercospora delaireae has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes1

GenBank sequences4

eDNA detections17

Countries12

The DNA barcodea real sequence read deposited for this species

ITSJX143587.1 ↗477 bpSouth Africa

ACGT

GGATCATTACTGAGTGAGGGCCTTCGGGCTCGACCTCCAACCCTTTGTGAACACAACTTGTTGCTTCGGGGGCGACCCTGCCGTTTCGAC …

Cercospora delaireae strain CBS 132595 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS4

fungal barcode

08Occurrence & distribution

Record type15 records

Museum / vouchered15

Range

Area of Occupancy AOO52 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 15 records without

Open the institutions mapphysical evidence15

09Environmental DNA17 detections

Where the DNA of Cercospora delaireae was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found17

Studies independent surveys3

Countries12

Verifiable raw sequence linked1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 17 detections have coordinates

Open the map12 countries0

NeotropicPalearcticAfrotropicIndomalayan

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.1 °C 18.0–26.7

Seasonal swing summer↔winter5.10 °C

Max temp (day)28.0 °C 22.6–31.5

Min temp (night)16.3 °C 11.7–21.9

Precipitation86.4 mm/mo 34.5–128

Air humidity57.7 % 48.3–66.8

Moisture balance-57.3 mm/mo -112–11.9

Vapour deficit1,186 Pa 812–1,545

Wind speed2.00 m/s 1.10–3.70

Cloud cover27.8 % 16.3–43.0

CHELSA 1981–2010, ~9 km grid, at location & month of 15 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.