Cercospora beticola

Sacc. · species

image placeholder — illustration coming later

Fungi/Ascomycota/Dothideomycetes/Mycosphaerellales/Mycosphaerellaceae/Cercospora

At a glance

Occurrence records1 122

Data sources11

Biological traits0

DNA specimens58

eDNA detections61

Sources11 archives

Databases and archives Cercospora beticola's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 122 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI61 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics58 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionLOTUS14 compounds

Occurrence & distributionGBIF1 122 records

Environmental DNA4 datasets · 8 countries61 detections

DNA & barcodingBOLD · NCBI58 specimens

Genome at a glanceGoaT · NCBI≈37 Mbp

01Narrative

Cercospora beticola is a fungal plant pathogen which typically infects plants of the genus Beta, within the family of Chenopodiaceae. It is the cause of Cercospora leaf spot disease in sugar beets, spinach and swiss chard. Of these hosts, Cercospora leaf spot is the most economically impactful in sugar beets (Beta vulgaris). Cercospora beticola is a deuteromycete fungus that reproduces using conidia. There is no teleomorph stage. C. beticola is a necrotrophic fungus that uses phytotoxins specifically Cercospora beticola toxin (CBT) to kill infected plants. CBT causes the leaf spot symptom and prevents root formation. Yield losses from Cercospora leaf spot are around 20 percent.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition14 compounds

Compounds documented for Cercospora beticola across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Anthraquinones and anthrones9

Shikimic acids and derivatives $ Simple phenolic acids1

Dicarboxylic acids1

Chromones1

Bisnaphthalenes1

Documented compounds14 total

Tissue Source Quantified only

Compound	Amount	Source
(3R)-3,7,8-trihydroxy-3-methyl-10-oxo-1,4-dihydropyrano[4,3-b]chromene-9-carboxylic acid	present	LOTUS
2-Furancarboxylic acid	present	LOTUS
4-Hydroxybenzaldehyde	present	LOTUS
Beticolin 0	present	LOTUS
Beticolin 3	present	LOTUS
Cebetin A	present	LOTUS
Cercosporin	present	LOTUS
CID 101928128	present	LOTUS
methyl (1R,12R,13R,17S)-4-chloro-5,7,12,20,22,25-hexahydroxy-30-methyl-9,18,27-trioxo-14,29-dioxaoctacyclo[15.10.3.01,19.03,16.06,15.08,13.021,26.028,30]triaconta-3(16),4,6(15),7,19,21,23,25-octaene-13-carboxylate	present	LOTUS
methyl (1R,7S,8R,17S,28S,30R)-4-chloro-8,13,15,20,22,25-hexahydroxy-30-methyl-11,18,27-trioxo-6,29-dioxaoctacyclo[15.10.3.01,19.03,16.05,14.07,12.021,26.028,30]triaconta-3(16),4,12,14,19,21,23,25-octaene-7-carboxylate	present	LOTUS

05DNA & barcoding58 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cercospora beticola has left across the world's sequence archives.

At a glance

DNA specimens58

Marker genes1

GenBank sequences10

eDNA detections61

Countries8

The DNA barcodea real sequence read deposited for this species

ITSMH855153.1 ↗481 bpGermany

ACGT

GGATCATTACTGAGTGAGGGCCTTCGGGCTCGACCTCCAACCCTTTGTGAACACAACTTGTTGCTTCGGGGGCGACCCTGCCGTTTCGAC …

Cercospora beticola strain CBS 122.31 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10

fungal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Cercospora beticola carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈36 565 572 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

THIS GENOME Cercospora beticola0.04 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelComplete Genome

Completeness98.6% BUSCO

08Occurrence & distribution

Record type1 122 records

Wild obs. + sensor58

Museum / vouchered1 024

Cultivated / captive10

Other30

Range

Area of Occupancy AOO2 092 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy59% within 1 km

≤100 m 18≤1 km 4≤10 km 15

37 georeferenced · 21 without coordinates

Open the mapobservation + sensor58

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy5% within 1 km

≤1 km 43≤10 km 554>10 km 229

826 georeferenced · 198 without coordinates

Open the institutions mapphysical evidence1 024

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 10 records without

Open the mapnot free-living10

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions24 of 42 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
ILLSlocation not on record	313
Bernard Price Institute for Palaeontological Researchlocation not on record	228
Catholic University of Pekinglocation not on record	127
Madison, US	43
DPIlocation not on record	36
Lincoln, US	33
Champaign, US	26
McWane Science Centerlocation not on record	23
Pullman, US	17
Auckland, NZ	16
Chicago, US	11
Brown Universitylocation not on record	8
TENN-Flocation not on record	7
Bronx, US	7
Uppsala, SE	6
Toronto, CA	6
Kew, GB	5
Karlsruhe, DE	4
PHlocation not on record	4
Grupo Actinomicetales Merida Facultad de Medicinalocation not on record	4
Clemson, US	3
WU-MYClocation not on record	3
Museo Entomologico de Leonlocation not on record	2
Chapel Hill, US	2
MeiseBGlocation not on record	2
Canadian Department of Agriculturelocation not on record	2
LDlocation not on record	2
Kensington, AU	1
Baton Rouge, US	1
FLASlocation not on record	1
University of Tennessee at Chattanoogalocation not on record	1
Parkville, AU	1
Hirosaki Universitylocation not on record	1
Ann Arbor, US	1
Mlocation not on record	1
Vancouver, CA	1
Tartu, EE	1
Cincinnati, US	1
Görlitz, DE	1
Kuopio, FI	1
Stockholm, SE	1
Copenhagen, DK	1

42 institutions · 955 of 1 024 vouchered records shown · 42 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA61 detections

Where the DNA of Cercospora beticola was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found61

Studies independent surveys4

Countries8

Verifiable raw sequence linked3

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 61 detections have coordinates

Open the map8 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median8.30 °C 5.70–16.3

Seasonal swing summer↔winter17.7 °C

Max temp (day)11.9 °C 9.20–22.1

Min temp (night)4.60 °C 1.40–10.6

Precipitation58.1 mm/mo 34.6–130

Air humidity62.6 % 52.0–64.0

Moisture balance-4.10 mm/mo -95.6–54.3

Vapour deficit449 Pa 357–1,091

Wind speed3.70 m/s 2.90–5.90

Cloud cover41.7 % 27.7–43.0

CHELSA 1981–2010, ~9 km grid, at location & month of 27 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Cercospora beticola

At a glance

Sources11 archives

Compound class profile5 classes

Documented compounds14 total

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type1 122 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions24 of 42 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 122 records