Cercospora arachidicola

Hori · species

image placeholder — illustration coming later

Fungi/Ascomycota/Dothideomycetes/Mycosphaerellales/Mycosphaerellaceae/Cercospora

At a glance

Occurrence records22

Data sources9

Biological traits0

DNA specimens0

eDNA detections2

Sources9 archives

Databases and archives Cercospora arachidicola's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility22 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionLOTUS10 compounds

Occurrence & distributionGBIF22 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingNCBIsequences

Genome at a glanceGoaT · NCBI≈38 Mbp

01Narrative

Cercospora arachidicola is a fungal ascomycete plant pathogen that causes early leaf spot of peanut. Peanuts (Arachis hypogaea) originated in South America and are cultivated globally in warm, temperate and tropical regions. All cultivars of peanuts are equally susceptible to peanut fungal pathogens; however, C. arachidicola is an economically important peanut pathogen and is responsible for significant economic losses in the peanut industry, more specifically in the Southeastern, Eastern, and the Southwestern United States. Early leaf spot of peanut can drastically reduce yields, leading to economic downturn of the peanut crop economy. Annual crop losses in the United States range anywhere from less than 1% to greater than 50% depending on disease management and treatment.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition10 compounds

Compounds documented for Cercospora arachidicola across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Anthraquinones and anthrones10

Documented compounds10 total

Tissue Source Quantified only

Compound	Amount	Source
(-)-Averantin	present	LOTUS
(1R,17R)-3,7,9-trihydroxy-17-methyl-16,21-dioxapentacyclo[15.3.1.02,15.04,13.06,11]henicosa-2(15),3,6(11),7,9,13-hexaene-5,12-dione	present	LOTUS
(1S,17R,20R)-3,7,9,20-tetrahydroxy-17-methyl-16,21-dioxapentacyclo[15.3.1.02,15.04,13.06,11]henicosa-2(15),3,6(11),7,9,13-hexaene-5,12-dione	present	LOTUS
(2R,3aR,12aS)-2,3,3a,12a-Tetrahydro-2,3a,4,6,9-pentahydroxyanthra(2,3-b)furo(3,2-d)furan-5,10-dione	present	LOTUS
(4R,6S,8S)-2,4,6,15,18-pentahydroxy-7,9-dioxapentacyclo[10.8.0.03,10.04,8.014,19]icosa-1,3(10),11,14,16,18-hexaene-13,20-dione	present	LOTUS
(4R,8R)-2,4,15,18-tetrahydroxy-7,9-dioxapentacyclo[10.8.0.03,10.04,8.014,19]icosa-1,3(10),11,14,16,18-hexaene-13,20-dione	present	LOTUS
3',4'-Dehydro-4'-deoxydothistromin	present	LOTUS
4',5-Bisdeoxy-dothistromin	present	LOTUS
Nidurufin	present	LOTUS
Versicolorin B	present	LOTUS

05DNA & barcoding10 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cercospora arachidicola has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences10

eDNA detections2

Countries2

The DNA barcodea real sequence read deposited for this species

ITSPQ062573.1 ↗405 bpIndia · 2023

ACGT

TATACCTACGCCGGGGGGCTTTCAAGCCCCGGGCAGCCGCCTCCCCCCCGACGCCCTCGCGCCTGGGAGGGGGAGGGCACCTTGCTTCGC …

Mycosphaerella arachidis isolate MA-OD small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, complete sequence; and 5.8S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10

fungal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Cercospora arachidicola carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈37 749 824 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

THIS GENOME Cercospora arachidicola0.04 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

Completeness98% BUSCO

08Occurrence & distribution

Record type22 records

Museum / vouchered22

Range

Area of Occupancy AOO84 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy48% within 1 km

≤1 km 10≤10 km 7>10 km 4

21 georeferenced · 1 without coordinates

Open the institutions mapphysical evidence22

10Collections & institutions

Holding institutions1 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bernard Price Institute for Palaeontological Researchlocation not on record	12
Grupo Actinomicetales Merida Facultad de Medicinalocation not on record	4
Catholic University of Pekinglocation not on record	3
MeiseBGlocation not on record	1
FLASlocation not on record	1
Madison, US	1

6 institutions · 22 of 22 vouchered records shown

09Environmental DNA2 detections

Where the DNA of Cercospora arachidicola was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)