Cercospora apii

Fresen. · species

image placeholder — illustration coming later

Fungi/Ascomycota/Dothideomycetes/Mycosphaerellales/Mycosphaerellaceae/Cercospora

At a glance

Occurrence records135

Data sources9

Biological traits0

DNA specimens29

eDNA detections36

Sources9 archives

Databases and archives Cercospora apii's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility135 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI36 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics29 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF135 records

Environmental DNA3 datasets · 4 countries36 detections

DNA & barcodingBOLD · NCBI29 specimens

Genome at a glanceGoaT · NCBI≈35 Mbp

01Narrative

Cercospora apii is a fungal plant pathogen, who causes leaf spot on celery, and found on other plants, including Impatiens. Since the genus Cercospora is one of the largest and most heterogeneous genera of hyphomycetes, numerous species described from diverse hosts and locations are morphologically indistinguishable from C. apii and subsequently are referred to as C. apii sensu lato.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding29 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cercospora apii has left across the world's sequence archives.

At a glance

DNA specimens29

Marker genes1

GenBank sequences10

eDNA detections36

Countries5

The DNA barcodea real sequence read deposited for this species

ITSMT804378.1 ↗470 bpIran

ACGT

GATCATTACTGAGTGAGGGCCTTCGGGCTCGACCTCCAACCCTTTGTGAACACAACTTGTTGCTTCGGGGGCGACCCTGCCGTTTCGACG …

Cercospora apii isolate IRAN_3922C internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10

fungal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Cercospora apii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈34 810 611 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

THIS GENOME Cercospora apii0.03 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

08Occurrence & distribution

Record type135 records

Wild obs. + sensor11

Museum / vouchered110

Cultivated / captive9

Other5

Range

Area of Occupancy AOO296 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy20% within 1 km

≤100 m 1≤1 km 1≤10 km 5>10 km 3

10 georeferenced · 1 without coordinates

Open the mapobservation + sensor11

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy17% within 1 km

≤100 m 2≤1 km 3≤10 km 17>10 km 7

29 georeferenced · 81 without coordinates

Open the institutions mapphysical evidence110

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

>10 km 1

1 georeferenced · 8 without coordinates

Open the mapnot free-living9

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Auckland, NZ	28
Bronx, US	12
Chicago, US	11
Kensington, AU	5
Leicester, GB	5
DPIlocation not on record	5
Toronto, CA	4
Canadian Department of Agriculturelocation not on record	4
Université de Montréal Biodiversity Centrelocation not on record	4
TROMlocation not on record	2
Parkville, AU	2
Museo Entomologico de Leonlocation not on record	2
Karlsruhe, DE	2
Helsinki, FI	2
Pullman, US	1
MeiseBGlocation not on record	1
ILLSlocation not on record	1
LDlocation not on record	1
Catholic University of Pekinglocation not on record	1
St. Paul, US	1

20 institutions · 94 of 110 vouchered records shown · 9 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA36 detections

Where the DNA of Cercospora apii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found36

Studies independent surveys3

Countries4

Verifiable raw sequence linked2

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 36 detections have coordinates

Open the map4 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median7.40 °C 5.70–15.0

Seasonal swing summer↔winter21.7 °C

Max temp (day)9.60 °C 9.20–19.7

Min temp (night)3.00 °C 1.40–10.6

Precipitation130 mm/mo 57.6–344

Air humidity62.6 % 61.0–64.9

Moisture balance54.3 mm/mo -9.70–263

Vapour deficit428 Pa 357–757

Wind speed2.90 m/s 1.70–5.90

Cloud cover44.6 % 38.9–46.6

CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)