Cerbera odollam

Gaertn. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Gentianales/Apocynaceae/Cerbera

At a glance

Occurrence records1 235

Data sources13

Biological traits18

DNA specimens3

eDNA detections3

Sources13 archives

Databases and archives Cerbera odollam's data was compiled from.

WikipediaWikimedia Foundation11 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 235 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources18 traits

Chemical compositionLOTUS · NPASS112 compounds

Occurrence & distributionGBIF1 235 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB2n = 40

01Narrative

Cerbera odollam, the pong-pong tree is a dicotyledonous angiosperm, a plant species in the family Apocynaceae and commonly known as the suicide tree, pong-pong, mintolla, and othalam. It bears a fruit known as othalanga (Malayalam: ഒതളങ്ങ) that yields a potent poison that has been used for suicide and murder. It is a species native to India and other parts of southern Asia, growing preferentially in coastal salt swamps and in marshy areas but also grown as a hedge plant between home compounds.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology1

Plant height10 m

Life cycle & reproduction5

Deciduousnessevergreen

Dispersal typewater

Life formshrub or tree

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Growth formtree

Succulenceno

Woodinesswoody

Physiology & chemistry3

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Wood density300 mg/cm³

Other traits1

Plant support typefree-standing

03Chemical composition112 compounds

Compounds documented for Cerbera odollam across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Cardenolides24

Iridoids monoterpenoids9

Labdane diterpenoids9

Furanoid lignans $ Neolignans6

Labdane diterpenoids $ Norlabdane diterpenoids5

Documented compounds112 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Cycloolivil	present	LOTUS
(1R,4As,8Ar)-5,5,8A-Trimethyl-4-Oxo-1-[(E)-2-(5-Oxo-2H-Furan-4-Yl)Ethenyl]-4A,6,7,8-Tetrahydro-1H-Naphthalene-2-Carbaldehyde	present	NPASS
(1S,4R,7R)-1-(2-hydroxyethyl)-7-(hydroxymethyl)-2-oxabicyclo[2.2.1]heptan-7-ol	present	LOTUS
(2R,3R,4R,5S,6R)-2-[2-[(1S,4R,7R)-7-hydroxy-7-(hydroxymethyl)-2-oxabicyclo[2.2.1]heptan-1-yl]ethoxy]-6-(hydroxymethyl)oxane-3,4,5-triol	present	LOTUS
(3E,5R)-3-[2-[(1S,4aS,8aS)-5,5,8a-trimethyl-2-methylidene-3,4,4a,6,7,8-hexahydro-1H-naphthalen-1-yl]ethylidene]-5-hydroxyoxolan-2-one	present	NPASS
(3R,4R,5S)-5-(4-hydroxy-3-methoxyphenyl)-3-[[(2R,3R)-2-(4-hydroxy-3-methoxyphenyl)-3-(hydroxymethyl)-7-methoxy-2,3-dihydro-1-benzofuran-5-yl]methyl]-4-(hydroxymethyl)oxolan-3-ol	present	LOTUS
(3S,4R,5S)-3-[[4-hydroxy-3-[2-hydroxy-5-[[(3S,4R,5S)-3-hydroxy-5-(4-hydroxy-3-methoxyphenyl)-4-(hydroxymethyl)oxolan-3-yl]methyl]-3-methoxyphenyl]-5-methoxyphenyl]methyl]-5-(4-hydroxy-3-methoxyphenyl)-4-(hydroxymethyl)oxolan-3-ol	present	LOTUS
(3S,4R,5S)-5-[4-hydroxy-3-[2-hydroxy-5-[(2S,3R,4S)-4-hydroxy-4-[(4-hydroxy-3-methoxyphenyl)methyl]-3-(hydroxymethyl)oxolan-2-yl]-3-methoxyphenyl]-5-methoxyphenyl]-3-[(4-hydroxy-3-methoxyphenyl)methyl]-4-(hydroxymethyl)oxolan-3-ol	present	LOTUS
(3S,4R,5S)-5-[4-hydroxy-3-[2-hydroxy-5-[[(3S,4R,5S)-3-hydroxy-5-(4-hydroxy-3-methoxyphenyl)-4-(hydroxymethyl)oxolan-3-yl]methyl]-3-methoxyphenyl]-5-methoxyphenyl]-3-[(4-hydroxy-3-methoxyphenyl)methyl]-4-(hydroxymethyl)oxolan-3-ol	present	LOTUS
(3S,4S,5S)-3-[[4-hydroxy-3-[2-hydroxy-5-[[(3S,4S,5R)-3-hydroxy-5-(4-hydroxy-3-methoxyphenyl)-4-(hydroxymethyl)oxolan-3-yl]methyl]-3-methoxyphenyl]-5-methoxyphenyl]methyl]-5-(4-hydroxy-3-methoxyphenyl)-4-(hydroxymethyl)oxolan-3-ol	present	LOTUS

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cerbera odollam has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes3

GenBank sequences9

eDNA detections3

Countries2

The DNA barcodea real sequence read deposited for this species

ITSMK895645.1 ↗322 bpVanuatu · 2006

ACGT

GAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGTTGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTAGCCCCCCA …

Cerbera odollam 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK4★rbcL4★ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Cerbera odollam carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 40 n = 20

Ploidypolyploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 401×CCDB · book-indian_vol1

CCDB · book-indian_vol1 — Rau, M.A. 1941

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 235 records

Wild obs. + sensor1 001

Museum / vouchered231

Other3

Origin

Native1

Range

Area of Occupancy AOO1 936 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 261≤1 km 112≤10 km 25>10 km 22

420 georeferenced · 581 without coordinates

Open the mapobservation + sensor1 001

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy48% within 1 km

≤100 m 1≤1 km 10≤10 km 10>10 km 2

23 georeferenced · 208 without coordinates

Open the institutions mapphysical evidence231

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions20 of 25 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Auckland, NZ	13
Kew, GB	12
Bronx, US	6
Saint Louis, US	5
Paris, FR	4
Baroda, IN	3
Wlocation not on record	3
BISHlocation not on record	3
Burlington, US	2
Smithfield, AU	2
EL PASO, US	2
Stockholm, SE	2
St. Augustine, TT	2
University of Stellenboschlocation not on record	2
Wellington, NZ	1
MeiseBGlocation not on record	1
Taipei, TW	1
St. Paul, US	1
Austin, US	1
Mount Annan, AU	1
Museo Entomologico de Leonlocation not on record	1
Pondicherry, IN	1
Honolulu, US	1
Zürich, CH	1
Canberra, AU	1

25 institutions · 72 of 231 vouchered records shown · 157 without an institution code

09Environmental DNA3 detections

Where the DNA of Cerbera odollam was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.1 °C 25.1–25.1

Seasonal swing summer↔winter16.5 °C

Max temp (day)30.5 °C

Min temp (night)19.3 °C

Precipitation109 mm/mo

Air humidity52.0 %

Moisture balance-17.8 mm/mo

Vapour deficit1,616 Pa

Wind speed1.80 m/s

Cloud cover25.2 %

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Cerbera odollam

At a glance

Sources13 archives

Size & morphology1

Life cycle & reproduction5

Diet & foraging1

Habitat & environment7

Physiology & chemistry3

Other traits1

Compound class profile5 classes

Documented compounds112 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 235 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions20 of 25 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 235 records