Cerbera floribunda

K.Schum. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Gentianales/Apocynaceae/Cerbera

At a glance

Occurrence records714

Data sources11

Biological traits30

DNA specimens9

eDNA detections6

Sources11 archives

Databases and archives Cerbera floribunda's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility714 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources30 traits

Chemical compositionLOTUS2 compounds

Occurrence & distributionGBIF714 records

Environmental DNA1 datasets · 3 countries6 detections

DNA & barcodingBOLD · NCBI9 specimens

01Narrative

Cerbera floribunda, commonly known as cassowary plum, grey milkwood, or rubber tree, is a plant in the family Apocynaceae which is native to the region from Sulawesi to the Solomon Islands, including north east Queensland.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology10

Fruit length100 mm

Fruit width52.5 mm

Leaf length165 mm

Leaf mass per area84.2 g/m2

Leaf size11 500 mm²

Leaf width35 mm

Petiole length3.5 cm

Plant height30 m

Seed length57.5 mm

Seed width35 mm

Life cycle & reproduction6

Deciduousnessevergreen

Flowering timeyyyyyyyyyynn

Life formtree

Life spanperennial

Raunkiær life formphanerophyte

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessfleshy

Fruit typedrupe

Growth formtree

Leaf compoundnesssimple

Leaf shapeelliptical lanceolate obtriangular

Woodinesswoody

Physiology & chemistry2

Photosynthetic pathwayC3

Wood density426 mg/cm³

Other traits1

Plant support typefree-standing

03Chemical composition2 compounds

Compounds documented for Cerbera floribunda across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Cardenolides2

Documented compounds2 total

Tissue Source Quantified only

Compound	Class	Amount	Source
[(2S,3R,4S,5S,6R)-5-hydroxy-2-[[(1S,2S,4R,5S,6R,9S,10R,13R,15S,18R)-9-hydroxy-5,18-dimethyl-6-(5-oxo-2H-furan-3-yl)-3-oxapentacyclo[8.8.0.02,4.05,9.013,18]octadecan-15-yl]oxy]-4-methoxy-6-methyloxan-3-yl] acetate		present	LOTUS
Cerbertin		present	LOTUS

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cerbera floribunda has left across the world's sequence archives.

At a glance

DNA specimens9

Marker genes5

GenBank sequences5

eDNA detections6

Countries3

The DNA barcodea real sequence read deposited for this species

rbcLJF738836.1 ↗526 bpPapua New Guinea · 2007

ACGT

GAGTACAAATTGACTTATTATACTCCTGAATACGAAACTAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTT …

Cerbera floribunda voucher WP3D0704 ribulose-1,5-bisphophate carboxylase oxygenase (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcL5★rbcLa★ITS2trnH-psbA

plant barcodefungal barcodemarker

08Occurrence & distribution

Record type714 records

Wild obs. + sensor180

Museum / vouchered398

Cultivated / captive1

Other135

Origin

Native8

Range

Area of Occupancy AOO1 040 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 84≤1 km 29≤10 km 9>10 km 6

128 georeferenced · 52 without coordinates

Open the mapobservation + sensor180

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy29% within 1 km

≤100 m 5≤1 km 38≤10 km 85>10 km 21

149 georeferenced · 249 without coordinates

Open the institutions mapphysical evidence398

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions17 of 23 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Canberra, AU	69
Brisbane, AU	47
Smithfield, AU	46
Kew, GB	18
Museo Entomologico de Leonlocation not on record	15
Honolulu, US	10
St. Paul, US	9
Saint Louis, US	9
Mount Annan, AU	8
BISHlocation not on record	6
University of Stellenboschlocation not on record	4
Cibinong, ID	3
Bronx, US	3
Fort Worth, US	3
Edinburgh, GB	2
Miami, US	2
Dekalb, US	2
Llocation not on record	2
Palmerston, AU	2
Cambridge, US	1
Taipei, TW	1
Cibinong Science Center, Herbarium Bogorienselocation not on record	1
ASUlocation not on record	1

23 institutions · 264 of 398 vouchered records shown · 129 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA6 detections

Where the DNA of Cerbera floribunda was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.8 °C 22.3–23.5

Seasonal swing summer↔winter1.80 °C

Max temp (day)25.4 °C 25.4–27.1

Min temp (night)20.7 °C 17.8–21.9

Precipitation341 mm/mo 178–369

Air humidity74.2 % 58.8–74.7

Moisture balance252 mm/mo 54.6–259

Vapour deficit715 Pa 715–1,185

Wind speed2.10 m/s 2.10–3.10

Cloud cover49.9 % 34.0–55.9

CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)