Ceratozamia latifolia

Miq. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Cycadopsida/Cycadales/Zamiaceae/Ceratozamia

At a glance

Occurrence records93

Data sources8

Biological traits10

DNA specimens0

eDNA detections0

Sources8 archives

Databases and archives Ceratozamia latifolia's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility93 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources10 traits

Occurrence & distributionGBIF93 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 16

01Narrative

Ceratozamia latifolia Miq., 1848 è una pianta appartenente alla famiglia delle Zamiaceae diffusa sui monti della Sierra Madre Orientale, in Messico. Il suo nome deriva dal latino, e significa "foglia larga".

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Life cycle & reproduction3

Life formsubshrub

Life spanperennial

Raunkiær life formchamaephyte

Diet & foraging1

Parasiteindependent

Habitat & environment5

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Growth formshrub

Woodinesswoody

Other traits1

Plant support typefree-standing

05DNA & barcoding4 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ceratozamia latifolia has left across the world's sequence archives.

At a glance

Marker genes3

GenBank sequences4

Countries1

The DNA barcodea real sequence read deposited for this species

ITSPP855180.1 ↗1 023 bpMexico · 2016

ACGT

ATCATTGGCACCTCGCCTCTGGTCGTTAAGAGAAACGAGTGAACCGTCAAAATTCGGTGCCTCGTGGCTGCTGTTGCTGGTATCCAGTCC …

Ceratozamia latifolia voucher MARTINEZ-DOMINGUEZETAL-818 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Ceratozamia latifolia carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 16 n = 8

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 161×CCDB · Rastogi2019

CCDB · Rastogi2019 — Moretti A. Karyotype data on North and Central American Zamiaceae (Cycadales) and their phylogenetic implications. Am J Bot. 1990;77:1016–29.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type93 records

Wild obs. + sensor6

Museum / vouchered87

Range

Area of Occupancy AOO124 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 6

6 georeferenced

Open the mapobservation + sensor6

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 32≤1 km 1

33 georeferenced · 54 without coordinates

Open the institutions mapphysical evidence87

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Durango, MX	68
Miami, US	7
Mexico City, MX	6
Saint Louis, US	2
Instituto de Investigaciones Biológicas, Universidad Veracruzana, Región Xalapalocation not on record	2
Riverside, US	1
Denver, US	1

7 institutions · 87 of 87 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)