Ceratocystis fimbriata

Ellis & Halst. · species

image placeholder — illustration coming later

Fungi/Ascomycota/Sordariomycetes/Microascales/Ceratocystidaceae/Ceratocystis

At a glance

Occurrence records135

Data sources12

Biological traits0

DNA specimens222

eDNA detections221

Sources12 archives

Databases and archives Ceratocystis fimbriata's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility135 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI221 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics222 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionLOTUS · NPASS47 compounds

Occurrence & distributionGBIF135 records

Environmental DNA2 datasets · 13 countries221 detections

DNA & barcodingBOLD · NCBI222 specimens

Genome at a glanceGoaT · NCBI≈36 Mbp

01Narrative

Ceratocystis fimbriata is a fungus and a plant pathogen, attacking such diverse plants as the sweet potato (black rot) and the tapping panels of the Para rubber tree (moldy rot). It is a diverse species that attacks a wide variety of annual and perennial plants. There are several host-specialized strains, some of which, such as Ceratocystis platani that attacks plane trees, are now described as distinct species.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition47 compounds

Compounds documented for Ceratocystis fimbriata across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Acyclic monoterpenoids10

Isocoumarins10

Naphthalenones6

Eudesmane sesquiterpenoids4

Simple coumarins4

Documented compounds47 total

Tissue Source Quantified only

Compound	Amount	Source
(1R,7S,8R,11R)-7-hydroxy-11-(hydroxymethyl)-15-methyl-12,13-dithia-9,15-diazatetracyclo[9.2.2.01,9.03,8]pentadeca-3,5-diene-10,14-dione	present	LOTUS
(1S,3S,4'S,5R)-1-(furan-3-yl)-4',5-dimethylspiro[2,8-dioxabicyclo[3.2.1]octane-3,2'-oxolane]	present	LOTUS
(2E,6E,9R)-9-hydroxy-3,7,11-trimethyldodeca-2,6,10-trienoic acid	present	LOTUS
(2S,3R,4S,5S,6R)-2-[[(1S,3R,3aS,4S,6S,6aS)-3-hydroxy-1,4-bis(4-hydroxy-3-methoxyphenyl)-1,3,3a,4,6,6a-hexahydrofuro[3,4-c]furan-6-yl]oxy]-6-(hydroxymethyl)oxane-3,4,5-triol	present	NPASS
(3R)-3,8-dihydroxy-3,4-dihydro-2H-naphthalen-1-one	present	LOTUS
(3S)-3-methyl-1,3-dihydroindol-2-one	present	LOTUS
(4E)-5-[(1S)-1-hydroxy-2,6,6-trimethyl-4-oxocyclohex-2-en-1-yl]-3-methylpenta-2,4-dienoic acid	present	LOTUS
(4S)-1-(Furan-3-Yl)-4-Hydroxypentan-1-One	present	NPASS
(4S,8S)-1-(furan-3-yl)-4,9-dihydroxy-4,8-dimethylnonane-1,6-dione	present	LOTUS
(E)-1,6-Dioxo-isodendrolasin	present	LOTUS

05DNA & barcoding222 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ceratocystis fimbriata has left across the world's sequence archives.

At a glance

DNA specimens222

Marker genes3

GenBank sequences10

eDNA detections221

Countries22

The DNA barcodea real sequence read deposited for this species

ITSPX854842.1 ↗454 bpIndonesia · 2025

ACGT

CTGAGTTTTTGTACTCTATAAACCATGTGTGAACGTACCCTATCTTGTAGTGAGATGAATGCTGTTTTGGTGGTAGGGCCCTTCTGAAGA …

Ceratocystis fimbriata isolate C7ME internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★ITS10★ITS1

animal barcodefungal barcode

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_044963 ↗ · 52 protein · 31 tRNA · 2 rRNA

oi1rnlrps3oi3rnlnad2nad3atp9cox2oi1cox2oi2cox2oi3cox2oi4cox2oi5cox2oi6cox2nad4Loi1nad4Lnad5oi1_1nad5oi1_2nad5oi2nad5oi3nad5oi4nad5oi5nad5oi6nad5oi7nad5coboi1cob+28

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

06Genome at a glanceGoaT · NCBI

The complete instruction manual Ceratocystis fimbriata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈36 097 259 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

THIS GENOME Ceratocystis fimbriata0.04 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

08Occurrence & distribution

Record type135 records

Wild obs. + sensor3

Museum / vouchered127

Cultivated / captive5

Range

Area of Occupancy AOO288 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy33% within 1 km

≤100 m 1≤10 km 2

3 georeferenced

Open the mapobservation + sensor3

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy18% within 1 km

≤1 km 2≤10 km 7>10 km 2

11 georeferenced · 116 without coordinates

Open the institutions mapphysical evidence127

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

>10 km 1

1 georeferenced · 4 without coordinates

Open the mapnot free-living5

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bernard Price Institute for Palaeontological Researchlocation not on record	10
DPIlocation not on record	8
Auckland, NZ	5
Catholic University of Pekinglocation not on record	2
Bronx, US	1
Champaign, US	1

6 institutions · 27 of 127 vouchered records shown · 75 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA221 detections

Where the DNA of Ceratocystis fimbriata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found221

Studies independent surveys2

Countries13

Verifiable raw sequence linked1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 221 detections have coordinates

Open the map13 countries0

stem

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.6 °C 12.5–25.9

Seasonal swing summer↔winter3.20 °C

Max temp (day)24.6 °C 17.7–29.0

Min temp (night)17.4 °C 8.20–24.1

Precipitation184 mm/mo 126–282

Air humidity67.3 % 62.0–71.2

Moisture balance71.0 mm/mo

Vapour deficit731 Pa 545–1,234

Wind speed2.00 m/s

Cloud cover31.5 % 27.8–45.1

CHELSA 1981–2010, ~9 km grid, at location & month of 26 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)