Ceraceomyces tessulatus

(Cooke) Jülich · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Amylocorticiales/Amylocorticiaceae/Ceraceomyces

At a glance

Occurrence records686

Data sources7

Biological traits0

DNA specimens0

eDNA detections110

Sources7 archives

Databases and archives Ceraceomyces tessulatus's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility686 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI110 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF686 records

Environmental DNA6 datasets · 9 countries110 detections

DNA & barcodingNCBIsequences

01Narrative

Echigoshirayukidake (Japanese: ), commonly called Basidiomycetes-X or BDM-X, is a sclerotium of Ceraceomyces tessulatus. It is classified as a basidiomycete because of its beak-shaped processes (Clamp connections). It does not form basidia and only forms sclerotia (hyphal masses) when cultured. In these respects, BDM-X is distinguished from other basidiomycetes. BDM-X is cultured and consumed as an edible mushroom. The mushroom, Basidiomycetes-X (BDM-X), echigoshirayukidake was identified as Ceraceomyces tessulatus, a member of the family Amylocorticiaceae based on the molecular analysis of ITS region and D1/D2 regions of rDNA. Sequence similarity between the mushroom and Ceraceomyces tessulatus voucher KHL16429, Herb. O (ACCESSION KU518951) was 99% in ITS1 region and 99% in 26 or 28S rDNA D1/D2 regions respectively.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding4 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ceraceomyces tessulatus has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences4

eDNA detections110

Countries9

The DNA barcodea real sequence read deposited for this species

ITSOR680678.1 ↗467 bpUSA · 2022

ACGT

AGAGGGGTTGTCGCTGGCCTTCATCGGCATGTGCACGCCCTGATCGACCTTTCATACACCTGTGCACATTCTGTAGGAGAGCGGGGAAAC …

Ceraceomyces tessulatus isolate Maricel Patino iNaturalist #144202059 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS4

fungal barcode

08Occurrence & distribution

Record type686 records

Wild obs. + sensor204

Museum / vouchered481

Other1

Origin

Native8

Range

Area of Occupancy AOO1 812 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy37% within 1 km

≤100 m 47≤1 km 21≤10 km 115>10 km 1

184 georeferenced · 20 without coordinates

Open the mapobservation + sensor204

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy76% within 1 km

≤100 m 83≤1 km 116≤10 km 58>10 km 5

262 georeferenced · 219 without coordinates

Open the institutions mapphysical evidence481

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions19 of 34 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Helsinki, FI	100
Olocation not on record	85
Oulu, FI	24
Görlitz, DE	21
SLU Artdatabankenlocation not on record	21
Copenhagen, DK	14
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	10
Zürich, CH	10
Toronto, CA	8
Trondheim, NO	8
Metsähallituslocation not on record	7
Mlocation not on record	7
Salamanca, ES	7
Göteborg, SE	3
Tartu, EE	3
Auckland, NZ	3
GJOlocation not on record	3
Uppsala, SE	3
Bronx, US	2
TROMlocation not on record	2
Turku, FI	2
nsnflocation not on record	2
MAlocation not on record	2
Kew, GB	1
Philadelphia, US	1
Senckenberg Gesellschaft für Naturforschung: Senckenberg Forschungsinstitut und Naturmuseumlocation not on record	1
Kuopio, FI	1
BioFokuslocation not on record	1
Joensuu, FI	1
MeiseBGlocation not on record	1
BDBClocation not on record	1
Jyväskylä, FI	1
University of the Basque Country (UPV/EHU)location not on record	1
Bernard Price Institute for Palaeontological Researchlocation not on record	1

34 institutions · 358 of 481 vouchered records shown · 123 without an institution code

09Environmental DNA110 detections

Where the DNA of Ceraceomyces tessulatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found110

Studies independent surveys6

Countries9

Verifiable raw sequence linked1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 110 detections have coordinates

Open the map9 countries0

PalearcticBirch(Hardwood) dowel buried in soil of a co…Birch(Hardwood) dowel buried in soil of a co…Pine(Softwood) dowel buried in soil of a mix…NearcticBirch(Hardwood) dowel buried in soil of a mi…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Measured at samplingin-field

pH5.40 4.70–7.10

Conductivity42.0 µS/cm 26.0–114

Organic carbon2.55 % 0.47–5.24

Water content18.5 % 4.45–37.1

Nitrate-N5.00 mg/kg

Phosphorus21.0 mg/kg 3.00–77.0

Clay28.0 % 14.3–30.8

Sand53.8 % 49.6–65.8

Depth0 m

SoilVertosolKurosolTenosolsSodosolKandosol

7 samples with on-site data · median with range · describes the sample, not the organism

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.9 °C -0.9–17.5

Seasonal swing summer↔winter23.2 °C

Max temp (day)13.1 °C 1.50–21.2

Min temp (night)7.20 °C -4.30–12.6

Precipitation80.0 mm/mo 36.2–102

Air humidity63.3 % 58.3–66.7

Moisture balance7.40 mm/mo -43.6–43.8

Vapour deficit474 Pa 206–850

Wind speed2.60 m/s 2.20–4.70

Cloud cover52.7 % 38.2–63.9

CHELSA 1981–2010, ~9 km grid, at location & month of 110 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)