Centaurea stoebe
speciesAt a glance
Occurrence records40 198
Data sources11
Biological traits39
DNA specimens46
eDNA detections23
Sources11 archives
Databases and archives Centaurea stoebe's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility40 198 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI23 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics46 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources39 traits
Chemical compositionLOTUS8 compounds
Occurrence & distributionGBIF40 198 records
Environmental DNA1 datasets · 4 countries23 detections
DNA & barcodingBOLD · NCBI46 specimens
Genome at a glanceCCDB1.6 Gbp
01Narrative
La Centaurée du Rhin est une espèce de plante à fleurs de la famille des astéracées.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPGIFTAusTraitsTRY
Size & morphology14
Fruit length2.85 mm
Leaf length max120 mm
Leaf size457 mm²
Leaf width40 mm
Leaf width max40 mm
Leaf width min40 mm
Plant height0.613 m
⚠ sources differ — GIFT: 0.613 m · AusTraits: 0.7 m · TRY: 1.09 m
Plant height generative0.875 m
Plant height max1.5 m
Plant height min0.2 m
Seed length2.5 mm
Seed mass1.88 mg
Seed mass max2.19 mg
Seed mass min1.32 mg
Life cycle & reproduction11
Deciduousnessaestival
Dispersal typewind
Flowering endSep
Flowering startJul
Life formperennial
Life spanbiennial
⚠ sources differ — TRY: biennial · AusTraits: annual biennial · GIFT: biennial
Lifespan years2 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formhemicryptophyte
Self fertilizationpresent
Diet & foraging1
Parasiteindependent
Habitat & environment9
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Epiphyteterrestrial
Fruit typeachene
Growth formherb
Habitat GIFTlimestone, mountains, steppe, stony places
Leaf shapelinear
Woodinessnon-woody
Physiology & chemistry3
Leaf dry-matter content (LDMC)134 mg/g
Photosynthetic pathwayC3
Specific leaf area (SLA)13.5 mm²/mg
⚠ sources differ — TRY: 13.5 mm²/mg · GIFT: 22.72 mm²/mg
Other traits1
Diaspore typeone-seeded generative dispersule
03Chemical composition8 compounds
Compounds documented for Centaurea stoebe across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile4 classes
Fatty aldehydes3
Germacrane sesquiterpenoids3
Cinnamic acids and derivatives1
Fatty alcohols $ Fatty aldehydes1
Documented compounds8 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (7E,9E,11E,13E)-hexadeca-7,9,11,13-tetraenal | present | LOTUS | |
| 1,11-Tridecadiene-3,5,7,9-tetrayne | present | LOTUS | |
| 3-(4-Hydroxy-3-Methoxyphenyl)Prop-2-Enoic Acid | present | LOTUS | |
| 6,8,10,12-Pentadecatetraenal | present | LOTUS | |
| [(3aR,4S,6E,10Z,11aR)-10-(hydroxymethyl)-6-methyl-3-methylidene-2-oxo-3a,4,5,8,9,11a-hexahydrocyclodeca[b]furan-4-yl] (3S)-3,4-dihydroxy-2-methylidenebutanoate | present | LOTUS | |
| [(3aS,4R,10S,11aR)-6-(hydroxymethyl)-10-methyl-3-methylidene-2-oxo-3a,4,7,8,9,10,11,11a-octahydrocyclodeca[b]furan-4-yl] 4-hydroxy-2-(hydroxymethyl)but-2-enoate | present | LOTUS | |
| [(3aS,4R,5E,10S,11aR)-6-(hydroxymethyl)-10-methyl-3-methylidene-2-oxo-3a,4,7,8,9,10,11,11a-octahydrocyclodeca[b]furan-4-yl] (E)-4-hydroxy-2-(hydroxymethyl)but-2-enoate | present | LOTUS |
05DNA & barcoding46 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Centaurea stoebe has left across the world's sequence archives.
At a glance
DNA specimens46
Marker genes7
GenBank sequences10
eDNA detections23
Countries11
The DNA barcodea real sequence read deposited for this species
TCGAAGCCTGCACAGCAGAACGACCCGTGAACATGTAATCACAACCGGGTGTCGTGGGGTCGGGTGCGAGCCTTAGCCCTGCGATGCTCG …
Centaurea stoebe isolate S1088 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK★rbcL2★rbcLa★trnL-F★ITS8★ITS2trnH-psbA
plant barcodefungal barcodemarker
06Genome at a glanceCCDB
The complete instruction manual Centaurea stoebe carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size1 613 700 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Centaurea stoebe1.61 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 18 n = 9
Ploidydiploid inferred
Chromosome records18–362n range18median18mode45records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 1828×CCDB · ita-fl · CCDB · slov-fl · CCDB · fl-europaea +7
CCDB · ita-fl — DAMBOLDT J., MATTHAES U. - 1975. Chromosomenzahlen einiger mediterraner und mitteleuropaeischer Centaurea-Arten (Asteraceae).. Pl. Syst. Evol. , 123: 107-115.
CCDB · ita-fl — LOON J.C., JONG H. - 1978. IOPB chromosome number reports LIX.. Taxon , 27(1): 57-60.
CCDB · slov-fl — Španiel S., 2007: [New records in Centaurea], pp. 179, 181-183. - In: Marhold K., Mártonfi P., Mereďa P. jun., Mráz P. (eds), Chromosome number survey of the ferns and flowering plants of Slovakia. Veda, Bratislava.
CCDB · fl-europaea — Guinochet, 1957
CCDB · fl-europaea — Majovsky et a l . ,
CCDB · poland — Skali?ska M., Czapik R., Piotrowicz M. et al. 1959. Further studies in chromosome numbers of Polish Angiosperms (Dicotyledons). Acta Soc. Bot. Pol. 28, 487-529.
CCDB · ipcn-api-dl — Georgiadis, T. 1980. Contribution à l'étude phylogénétique du genre Centaurea L. (Sectio Acrolophus (Cass.) DC.) en Grèce. Thesis, Universit;aae de Provence. Aix Marseilles. ý.
CCDB · ipcn-api-dl — Georgiadis, T. 1983. Contribution à l'étude cytogéographique du genre Centaurea L. (section Acrolophus (Cass.) DC.) en Gréce. Candollea 38: 3ý.
CCDB · ipcn-api-dl — Van Loon, J. C. 1982. In IOPB chromosome number reports LXXVII. Taxon 31: 763–764.
CCDB · ipcn-api-dl — Lovric, A. Z. 1982a. In IOPB chromosome number reports LXXVII. Taxon 31: 774–775.
CCDB · ipcn-api-dl — Damboldt, J. & U. MATTHAS. 1975. Chromosome numbers of some Mediterranean and C. European Centaurea species (Asteraceae). Pl. Syst. Evol. 123: 107–115.
CCDB · ipcn-api-dl — Kuzmanov, B., D. Ninova & S. Georgieva. 1981c. In Chromomsome number reports LXXII. Taxon 30:702.
CCDB · ipcn-api-dl — Damboldt, J. & U. MATTHAS. 1975. Chromosomenzahlen eininger mediterraner und mitteleuropaischer Centaurea-Arten (Asteraceae). Pl. Syst. Evol. 123: 107–115.
CCDB · ipcn-api-dl — Gregor, T. & R. Hand. 2007. Chromosomenzahlen von Farn- und Samenpflanzen aus Deutschland 2. Kochia 2: 31–35.
CCDB · ipcn-api-dl — Gregor, T. & R. Hand. 2008. Chromosomenzahlen von Farn- und Samenpflanzen aus Deutschland 3. Kochia 3: 55–60.
CCDB · ipcn-api-dl — Andreev, V. N. 1981. In Chromosome number reports LXX. Taxon 30: 74–75.
CCDB · book-ipcn75-78 — Kuzmanov & Georgieva 1976
CCDB · book-ipcn73-74 — GOCHU, D.I. 1973. Some data on the chromosome numbers of species of Centaurea L. growing in Moldavia. (in Russian) Bot. zurn. (Moscow & Leningrad) 58: 77-78.
CCDB · kew — Bancheva S, Greilhuber J. 2006. Genome size in Bulgarian Centaurea s.l. (Asteraceae). Plant Systematics and Evolution 257: 95-117.
CCDB · kew — Pustahija F, Brown SC, Bogunic F, Bašic N, Muratovic E, Ollier S, Hidalgo O, Bourge M, Stevanovic V, Sijak-Yakovev S. 2013. Small genomes dominate in plants growing on serpentine soils in West Balkans, an exhaustive study of 8 habitats covering 308 taxa.
CCDB · Cave1956 — Guinochet b
CCDB · iapt — IAPT/IOPB Chromosome Data 27
2n 3617×CCDB · ita-fl · CCDB · slov-fl · CCDB · ipcn-api-dl +5
CCDB · ita-fl — LOEVE A., LOEVE D. - 1982. IOPB chromosome number reports LXXVI.. Taxon , 31(3): 583-587.
CCDB · slov-fl — Španiel S., 2007: [New records in Centaurea], pp. 179, 181-183. - In: Marhold K., Mártonfi P., Mereďa P. jun., Mráz P. (eds), Chromosome number survey of the ferns and flowering plants of Slovakia. Veda, Bratislava.
CCDB · ipcn-api-dl — Love, A. & D. Love. 1982. In: IOPB chromosome number reports LXXVI. Taxon 31: 583–587.
CCDB · ipcn-api-dl — Kiehn, M., E. Vitek, E. Hellmayr, J. Walter, J. Tschenett, C. Justin & M. Mann. 1991. Beiträge zur Flora von Österreich: Chromosomenzählungen. Verh. Zool.-Bot. Ges. Wien 128: 19–39.
CCDB · ipcn-api-dl — Kuzmanov, B., D. Ninova & S. Georgieva. 1981c. In Chromomsome number reports LXXII. Taxon 30:702.
CCDB · ipcn-api-dl — Kuzmanov, B. & S. Georgieva. 1977. In IOPB chromosome number reports LVII. Taxon 26: 443–452.
CCDB · ipcn-api-dl — Taylor, R. L. & S. Taylor. 1977. Chromosome numbers of vascular plants of British Columbia. Syesis 10: 125–138.
CCDB · ipcn-api-dl — Hill, L. M. 1995. IOPB chromosome data 9. Int. Organ. Pl. Biosyst. Newslett. (Zurich) 24: 19–20.
CCDB · ipcn-api-dl — Kuzmanov, B. A., S. B. Georgieva & V. A. Nikolova. 1986. Chromosome numbers of Bulgarian flowering plants. I. Fam. Asteraceae. Fitologija 31: 71–74.
CCDB · book-ipcn73-74 — POWELL, A.M., D.W. KYHOS, & P.H. RAVEN. 1974. Chromosome numbers in Compositae. X. Amer. J. Bot. 61: 909-913.
CCDB · eflora
CCDB · book-atlas-flowering-plants — Moore & F. 1954
CCDB · kew — Bancheva S, Greilhuber J. 2006. Genome size in Bulgarian Centaurea s.l. (Asteraceae). Plant Systematics and Evolution 257: 95-117.
CCDB · kew — Pustahija F, Brown SC, Bogunic F, Bašic N, Muratovic E, Ollier S, Hidalgo O, Bourge M, Stevanovic V, Sijak-Yakovev S. 2013. Small genomes dominate in plants growing on serpentine soils in West Balkans, an exhaustive study of 8 habitats covering 308 taxa.
CCDB · Cave1962 — Guinochet & F. 1962
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type40 198 records
Wild obs. + sensor35 171
Museum / vouchered4 261
Cultivated / captive13
Other753
Origin
Introduced1 181
Range
Area of Occupancy AOO74 596 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy67% within 1 km
≤100 m 13 755≤1 km 3 462≤10 km 7 727>10 km 781
25 725 georeferenced · 9 446 without coordinates
Open the mapobservation + sensor35 171
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy39% within 1 km
≤100 m 245≤1 km 1 058≤10 km 1 955>10 km 43
3 301 georeferenced · 960 without coordinates
Open the institutions mapphysical evidence4 261
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy
no georeferenced coordinates · 13 records without
Open the mapnot free-living13
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions70 of 130 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 2 195 |
| BRNUlocation not on record | 481 |
| Berlin, DE | 166 |
| Uniwersytet Warszawskilocation not on record | 133 |
| LDlocation not on record | 101 |
| Görlitz, DE | 59 |
| BIO-UNIPIlocation not on record | 55 |
| GZUlocation not on record | 47 |
| Green Bay, US | 41 |
| Bern, CH | 41 |
| GJOlocation not on record | 38 |
| Moscow State Universitylocation not on record | 34 |
| Chongqing Museumlocation not on record | 34 |
| PRClocation not on record | 33 |
| BFLlocation not on record | 31 |
| SLU Artdatabankenlocation not on record | 29 |
| Bloomington, US | 26 |
| Zürich, CH | 25 |
| Provincia di Livornolocation not on record | 24 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 24 |
| Wlocation not on record | 22 |
| Zürich, CH | 22 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 21 |
| McWane Science Centerlocation not on record | 17 |
| Dekalb, US | 17 |
| Salzburg, AT | 17 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 17 |
| Ann Arbor, US | 15 |
| Oskarshamn, SE | 15 |
| Madison, US | 15 |
| No collectionlocation not on record | 13 |
| Flagstaff, US | 12 |
| New Brunswick, US | 11 |
| University of Stellenboschlocation not on record | 11 |
| St. Paul, US | 10 |
| IDElocation not on record | 10 |
| Dresden, DE | 9 |
| MeiseBGlocation not on record | 9 |
| Millersville, US | 9 |
| Boise, US | 9 |
| Mlocation not on record | 8 |
| College Park, US | 8 |
| Norfolk, US | 7 |
| Bronx, US | 7 |
| Whitehorse, CA | 7 |
| BGBMlocation not on record | 7 |
| BClocation not on record | 7 |
| Lausanne, CH | 7 |
| New Haven, US | 6 |
| WTUlocation not on record | 6 |
| Adam Mickiewicz University in Poznańlocation not on record | 5 |
| Philadelphia, US | 5 |
| DBF-NHMDlocation not on record | 5 |
| Canberra, AU | 5 |
| Moscow, US | 5 |
| Palacký University in Olomouclocation not on record | 5 |
| H-Hohlalocation not on record | 4 |
| Uniwersytet Śląski w Katowicachlocation not on record | 4 |
| Keene State Universitylocation not on record | 3 |
| Frauenfeld, CH | 3 |
| Olocation not on record | 3 |
| LfUlocation not on record | 3 |
| Pullman, US | 3 |
| Research Collection of B. A. Bennettlocation not on record | 3 |
| Karlsruhe, DE | 3 |
| Museo Entomologico de Leonlocation not on record | 3 |
| Frankfurt am Main | 3 |
| Provo, US | 2 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 2 |
| Smithsonian Institutionlocation not on record | 2 |
| SZUlocation not on record | 2 |
| Canadian Department of Agriculturelocation not on record | 2 |
| CJBGlocation not on record | 2 |
| Naturalis Biodiversity Centerlocation not on record | 2 |
| Nijmegen, NL | 2 |
| CJBNlocation not on record | 2 |
| University of Alberta Museumslocation not on record | 2 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 2 |
| Ypsilanti, US | 2 |
| Toronto, CA | 2 |
| Uniwersytet Opolskilocation not on record | 2 |
| Pocatello, US | 2 |
| Anchorage, US | 2 |
| US | 2 |
| John May Museum of Natural Historylocation not on record | 2 |
| München, DE | 2 |
| Science Museum of Minnesotalocation not on record | 2 |
| Caldwell, US | 1 |
| Fulda, DE | 1 |
| Pittsburg, US | 1 |
| Claremont, US | 1 |
| Yellowstone National Park Herbariumlocation not on record | 1 |
| Blacksburg, US | 1 |
| CASlocation not on record | 1 |
| Kuopio, FI | 1 |
| nbflocation not on record | 1 |
| Uppsala, SE | 1 |
| Dover, US | 1 |
| UoB-IBlocation not on record | 1 |
| Logan, US | 1 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 1 |
| Mohonk Preservelocation not on record | 1 |
| Fredericksburg, US | 1 |
| Whitewater, US | 1 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 1 |
| Vancouver, CA | 1 |
| Brussel, BE | 1 |
| National Institute of Biological Resourceslocation not on record | 1 |
| Bend, US | 1 |
| Mount Annan, AU | 1 |
| Kew, GB | 1 |
| Johnson City, US | 1 |
| Tacoma, US | 1 |
| Beijing, CN | 1 |
| GB | 1 |
| Bureau of Land Management, Medford District Officelocation not on record | 1 |
| Victoria, CA | 1 |
| Saint Louis, US | 1 |
| Göteborg, SE | 1 |
| Hobart, AU | 1 |
| Chapel Hill, US | 1 |
| Santa Barbara, US | 1 |
| Natural History Museum Rotterdamlocation not on record | 1 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 1 |
| Columbia, US | 1 |
| Sion, CH | 1 |
| Chadron, US | 1 |
| Cheney, US | 1 |
| Brisbane, AU | 1 |
| DULlocation not on record | 1 |
130 institutions · 4 116 of 4 261 vouchered records shown · 68 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA23 detections
Where the DNA of Centaurea stoebe was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found23
Studies independent surveys1
Countries4
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 23 detections have coordinates
Open the map4 countries0
Disturbed roadside.Growing in wet seep, likely thermally influe…
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median13.7 °C 4.70–16.4
Seasonal swing summer↔winter24.5 °C
Max temp (day)18.2 °C 7.90–20.4
Min temp (night)7.20 °C 0.5–14.6
Precipitation71.7 mm/mo 46.6–84.1
Air humidity61.5 % 56.7–62.9
Moisture balance-20.5 mm/mo -46.2–2.30
Vapour deficit633 Pa 318–772
Wind speed3.00 m/s 1.90–6.10
Cloud cover47.9 % 39.3–51.7
CHELSA 1981–2010, ~9 km grid, at location & month of 11 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.