Centaurea solstitialis
speciesAt a glance
Occurrence records23 797
Data sources13
Biological traits55
DNA specimens77
eDNA detections23
Sources13 archives
Databases and archives Centaurea solstitialis's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility23 797 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI23 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics77 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources55 traits
Chemical compositionLOTUS · NPASS109 compounds
Occurrence & distributionGBIF23 797 records
Environmental DNA1 datasets · 5 countries23 detections
DNA & barcodingBOLD · NCBI77 specimens
Genome at a glanceCCDB · GoaT · NCBI822 Mbp
01Narrative
La Centaurée du solstice est une espèce de plante à fleurs du genre Centaurea et de la famille des Astéracées poussant surtout dans les régions méridionales de l'Europe, facilement reconnaissable à ses capitules jaunes et à ses bractées terminées par de très longues épines.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTAusTraitsLEDATRYWCVP
Size & morphology16
Fruit length2.5 mm
⚠ sources differ — AusTraits: 2.5 mm · GIFT: 3 mm
Leaf length40 mm
Leaf length max200 mm
Leaf mass36.11 mg
Leaf size961 mm²
Leaf width5 mm
⚠ sources differ — AusTraits: 5 mm · GIFT: 20 mm
Leaf width max8 mm
Leaf width min2 mm
Plant height0.57 m
⚠ sources differ — GIFT: 0.57 m · AusTraits: 1 m · LEDA: 0.64 m · TRY: 0.593 m
Plant height generative0.682 m
Plant height max1 m
Plant height min0.15 m
Seed length3 mm
Seed mass3 mg
⚠ sources differ — TRY: 3 mg · LEDA: 1.68 mg · GIFT: 2.54 mg
Seed mass max5 mg
Seed mass min1.8 mg
Life cycle & reproduction15
Deciduousnessdeciduous
Dehiscenceindehiscent
Dispersal typehuman
⚠ sources differ — LEDA: speirochor · GIFT: anemochorous
Flowering endSep
Flowering startJul
Flowering timeyynnnnnnyyyy
Life formannual or biennial
Life spanannual
⚠ sources differ — TRY: annual · AusTraits: annual biennial · LEDA: strict monocarpic bi-annuals and poly-annuals · GIFT: annual
Lifespan years1.5 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formhemicryptophyte
⚠ sources differ — LEDA: Hemicryptophyte · GIFT: therophyte
Reproduction asexualabsent
Seed number1 538
Self fertilizationpresent
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment13
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max1 645 m
Elevation min0 m
Epiphyteterrestrial
Fruit typeachene
Growth formherb
Habitat GIFThills, mountains, ruderal sites, stony places
Leaf compoundnesssimple
Leaf shapelanceolate narrowly_lanceolate
Mycorrhiza type0.00000000295
Woodinessnon-woody
Physiology & chemistry7
Leaf C:N ratio31.5 g/g
Leaf c427 mg/g
Leaf dry-matter content (LDMC)184 mg/g
Leaf n12.9 mg/g
Photosynthetic pathwayC3
Seed longevity index0.5
Specific leaf area (SLA)19.97 mm²/mg
⚠ sources differ — TRY: 19.97 mm²/mg · LEDA: 27.77 mm²/mg · GIFT: 27.77 mm²/mg
Other traits2
Diaspore typefruit with appendage
Plant support typefree-standing
03Chemical composition109 compounds
Compounds documented for Centaurea solstitialis across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Guaiane sesquiterpenoids20
Flavonols20
Cinnamic acids and derivatives18
Aminoacids5
Flavones4
Documented compounds109 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (+)-Syringaresinol | present | LOTUS | |
| (-)-Arctigenin | present | LOTUS | |
| (-)-Caryophyllene | present | LOTUS | |
| (-)-Matairesinol | present | LOTUS | |
| (1R,2S,7S,8S)-1,3-dimethyl-8-propan-2-yltricyclo(4.4.0.02,7)dec-3-ene | present | LOTUS | |
| (1S,2E,10R)-3,7,11,11-tetramethylbicyclo[8.1.0]undeca-2,6-diene | present | LOTUS | |
| (2a(2)R,3aR,4S,6aR,8S,9aS,9bS)-Decahydro-8-hydroxy-3,6-bis(methylene)-2-oxospiro[azuleno[4,5-b]furan-9(2H),2a(2)-oxiran]-4-yl (2S)-3-chloro-2-hydroxy-2-methylpropanoate | present | LOTUS | |
| (2R)-2-[(E)-3-(4-hydroxyphenyl)prop-2-enoyl]oxybutanedioic acid | present | NPASS | |
| (3S)-7-hydroxy-3-(2-hydroxy-4-methoxyphenyl)-2,3-dihydrochromen-4-one | present | NPASS | |
| (8-Hydroxy-3,6,9-trimethylidene-2-oxo-3a,4,5,6a,7,8,9a,9b-octahydroazuleno[4,5-b]furan-4-yl) 3-chloro-2-hydroxy-2-methylpropanoate | present | LOTUS |
05DNA & barcoding77 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Centaurea solstitialis has left across the world's sequence archives.
At a glance
DNA specimens77
Marker genes6
GenBank sequences10
eDNA detections23
Countries12
The DNA barcodea real sequence read deposited for this species
TGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATTCGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATC …
Centaurea solstitialis voucher CCDB-22989-G04 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK2★rbcL1★rbcLa★ITS7★ITS2trnH-psbA
plant barcodefungal barcodemarker
06Genome at a glanceCCDB · GoaT · NCBI
The complete instruction manual Centaurea solstitialis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size821 520 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Centaurea solstitialis0.82 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 16 n = 8
Ploidy2× diploid · measured
Chromosome records16–182n range16median16mode61records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 1653×GoaT · Kew Plant DNA C-values Database · CCDB · ita-fl · CCDB · slov-fl +14
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · ita-fl — BINI MALECI L., MORI B. - 1972. Numeri cromosomici per la flora italiana:131-134.. Inform. Bot. Ital. , 4(3): 224-226.
CCDB · slov-fl — Májovský J. et al., 1970a: Index of chromosome numbers of Slovakian flora (Part 1). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 16: 1-26.
CCDB · iapt — IAPT/IOPB Chromosome Data 2
CCDB · iber-fl — Estudios citogenticos en especies espaolas del gnero Centaurea. Granada. Fernndez Morales, M. J.*(1974).
CCDB · iber-fl — IOPB. Chromosome number reports. XLVI. Fernndez Morales, M. J.Taxon23(5/6): 805(1974).
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=3875
CCDB · fl-europaea — Gadella & Kliphuis,
CCDB · ipcn-api-dl — Magulaev, A. Y. 1982. The number of chromosomes of the species of Asteraceae, Caryophyllaceae and Plantaginaceae of the North Caucasus. Biol. Nauki (Moscow) 11 (227): 74–79.
CCDB · ipcn-api-dl — Sekovski, Z. & M. Jovanovska. 1983. Chromosome atlas of some Macedonian angiosperms. IV. Ann. Fac. Biol. Univ. Skopje. 36: 73–86.
CCDB · ipcn-api-dl — Baltisberger, M. 1993. Zytologische Untersuchungen an Compositen aus Albanien. Candollea 48(2): 437–448.
CCDB · ipcn-api-dl — Turner, B. L., J. BACON, L. Urbatsh & B. Simpson. 1979. Chromosome numbers in South American Compositae. Amer. J. Bot. 66: 173–178.
CCDB · ipcn-api-dl — Kuzmanov, B., D. Ninova & S. Georgieva. 1979. In IOPB chromosome number reports LXIV. Taxon 28:408.
CCDB · ipcn-api-dl — Kuzmanov, B. & S. Georgieva. 1976. In IOPB chromosome number reports LIII. Taxon 25: 483–500.
CCDB · ipcn-api-dl — Bancheva, S. & J. Greilhuber. 2006. Genome size in Bulgarian Centaurea s.l. (Asteraceae). Pl. Syst. Evol. 257: 95–117.
CCDB · ipcn-api-dl — Gagnidze. 2006. Chromosome numbers of some species of the Georgian flora. Bot. Žhurn. (Moscow & Leningrad) 91(12): 1928–1929.
CCDB · ipcn-api-dl — Gagnidze. 2006. IAPT/IOPB chromosome data 2. Taxon 55(3): 757.
CCDB · ipcn-api-dl — Strid, A. & R. Franzen. 1981. In Chromosome number reports LXXIII. Taxon 30: 829–842.
CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Georgiadis, T. & D. Christodoulakis. 1984. Contribution à l'étude cytogéographique des Centaurées de l'île de Samos. Candollea 39: 307–318.
CCDB · ipcn-api-dl — Van Loon, J. C. 1980. In Chromosome number reports LXIX. Taxon 29: 718–720.
CCDB · book-ipcn72 — GADELLA, T., & E. KLIPHUIS. 1972. studies in chromosome numbers of Yugoslavian angiosperms. Acta Bot. Croatica 31: 91-103.
CCDB · book-ipcn72 — MALECI, L.B., & B. MORI. 1972. In Numeri cromosomici per la flora Italiana. Informatore Bot. Ital.4: 224-236.
CCDB · book-ipcn67-71 — MAJOVSKY, J., ET. AL. 1970. Index of chromosome numbers of Slovakian flora (Part 1). Acta Fae. Rerum Nat. Univ. Comenianae Bot. 16.: 1-26.
CCDB · book-ipcn67-71 — GUINOCHET, M. 1957. Contribution a l'etude caryologique du genre Centaurea L. sens. lat. soc. Hist. Nat. Afrique Nord 48: 282-300.
CCDB · book-ipcn67-71 — RUNEMARK, H. 1967. Studies in the Aegean flora. XII. Cytologic and morphologic investigations in Centaurea. Bot. Not. 120: 161-176.
CCDB · book-ipcn67-71 — TONJAN, Z.R. 1968. The chromosome numbers of some species of the genus Centaurea. (In Russian) Biol. Zurn. Arm. S.S.R. 21: 86-96.
CCDB · book-ipcn73-74 — FERNANDEZ MORALES, M.J. 1974. In IOPB chromosome number reports XLVJ Taxon 23: 801-812. I
CCDB · book-ipcn73-74 — POWELL, A.M., D.W. KYHOS, & P.H. RAVEN. 1974. Chromosome numbers in Compositae. X. Amer. J. Bot. 61: 909-913.
CCDB · eflora
CCDB · book-fedorov — Hindakova (I. Slov. fl. I. 1967)
CCDB · book-atlas-flowering-plants — Heiser & W. 1948
CCDB · kew — Bancheva S, Greilhuber J. 2006. Genome size in Bulgarian Centaurea s.l. (Asteraceae). Plant Systematics and Evolution 257: 95-117.
CCDB · Cave1962 — Guinochet & F. 1962
CCDB · CromoCat 2015 — Kuzmanov, B. & Georgieva, S. (1976). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LIII]. Taxon 25(4): 500.
CCDB · CromoCat 2015 — Bancheva, S. & Greilhuber, J. (2006). Genome size in Bulgarian Centaurea s.l. (Asteraceae). Plant Systematics and Evolution 257:95-117.
CCDB · CromoCat 2015 — Gagnidze (2006). Chromosome numbers of some species of the Georgian flora. Bot. Žhurn. 91(12): 1928–1929.
CCDB · CromoCat 2015 — Gagnidze, R., Gviniashvili, T. & Jinjolia, L. (2006). IAPT/IOPB Chromosome Data 2 Taxon 55(3): 757-758
CCDB · CromoCat 2015 — Bini Maleci, L. & Mori, B. (1972). Numeri cromosomici per la flora italiana: 131-134. Inf. Bot. Ital. 4: 224-227.
CCDB · CromoCat 2015 — Fernández Morales, M. J. (1974a). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports XLVI]. Taxon 23(5/6): 805.
+11 more references
2n 188×CCDB · ita-fl · CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · ita-fl — BRULLO S., PAVONE P. - 1978. Numeri cromosomici per la flora italiana:464-483.. Inform. Bot. Ital. , 10(2): 248-264.
CCDB · ipcn-api-dl — Jasiewicz, A. & M. Mizianty. 1975. Chromosome numbers of some Bulgarian plants. Fragm. Florist. Geobot. 21: 277–288.
CCDB · ipcn-api-dl — Tonian, T. R. 1980. Relation between chromosome number and some morphological features of Centaureinae Less representatives. Rev. Biol. 33 (5): 552–554.
CCDB · ipcn-api-dl
CCDB · CromoCat 2015 — Tonian, T. R. (1980). Relation between chromosome number and some morphological features of Centaureinae Less. representatives. Biol. Zurn. Armenii 33: 552-554.
CCDB · CromoCat 2015 — Jasiewicz, A. & Mizianty, M. (1975). Chromosome numbers of some Bulgarian plants. Fragm. Florist. Geobot. 12: 277-288.
CCDB · CromoCat 2015 — Kuzmanov, B. & Georgieva, S. (1990). Cytotaxonomy of Bulgarian Centaurea species. In: Razprave IV razr. SAZU 31(7): 105-125.
CCDB · CromoCat 2015 — Kuzmanov, B., Ninova, D. & Georgieva, S. (1981a). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXXII]. Taxon 30(3): 702.
2n 02×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Ghaffari, S. M. (1989). Chromosome studies in Iranian Compositae. Iranian J. Bot. 4: 189-196.
CCDB · CromoCat 2015 — Turner, B. L., J. Bacon, L. Urbatsch, & B. Simpson. (1979). Chromosome numbers in South American Compositae. Amer. J. Bot. 66: 173-178.
n 813×CCDB · iber-fl · CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 +2
CCDB · iber-fl — Estudios citogenticos en especies espaolas del gnero Centaurea. Granada. Fernndez Morales, M. J.*(1974).
CCDB · iber-fl — IOPB. Chromosome number reports. XLVI. Fernndez Morales, M. J.Taxon23(5/6): 805(1974).
CCDB · ipcn-api-dl — Ghaffari, S. M. 1989. Chromosome studies in Iranian Compositae. Iran. J. Bot. 4: 189–196.
CCDB · ipcn-api-dl — Turner, B. L., J. BACON, L. Urbatsh & B. Simpson. 1979. Chromosome numbers in South American Compositae. Amer. J. Bot. 66: 173–178.
CCDB · book-ipcn67-71 — DELAY, J. 1969. Haute Provence. Inf. Ann. Caryosyst. et Cytogenet. 3: 27-28.
CCDB · book-ipcn73-74 — FERNANDEZ MORALES, M.J. 1974. In IOPB chromosome number reports XLVJ Taxon 23: 801-812. I
CCDB · CromoCat 2015 — Delay, J. (1969b). Haute Provence. Inf. Ann. Caryosyst. et Cytogenet. 3: 27-28.
CCDB · CromoCat 2015 — Fernández Morales, M. J. (1974a). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports XLVI]. Taxon 23(5/6): 805.
CCDB · CromoCat 2015 — Fernández Morales, M. J. (1974b). Estudios citogenéticos en especies españolas del género Centaurea. Granada
CCDB · CromoCat 2015 — Powell, A. M., D. W. Kyhos & P. H. Raven. (1974). Chromosome numbers in Compositae. X. Amer. J. Bot. 61: 909-913.
CCDB · CromoCat 2015 — Turner, B. L., J. Bacon, L. Urbatsch, & B. Simpson. (1979). Chromosome numbers in South American Compositae. Amer. J. Bot. 66: 173-178.
CCDB · CromoCat 2015 — Ghaffari, S. M. (1989). Chromosome studies in Iranian Compositae. Iranian J. Bot. 4: 189-196.
n 04×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Bancheva, S. & Greilhuber, J. (2006). Genome size in Bulgarian Centaurea s.l. (Asteraceae). Plant Systematics and Evolution 257:95-117.
CCDB · CromoCat 2015 — Gagnidze (2006). Chromosome numbers of some species of the Georgian flora. Bot. Žhurn. 91(12): 1928–1929.
CCDB · CromoCat 2015 — Gagnidze, R., Gviniashvili, T. & Jinjolia, L. (2006). IAPT/IOPB Chromosome Data 2 Taxon 55(3): 757-758
CCDB · CromoCat 2015 — Tonian, T. R. (1980). Relation between chromosome number and some morphological features of Centaureinae Less. representatives. Biol. Zurn. Armenii 33: 552-554.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=0.996 ↗
Sequencing statusassembly quality — how far to trust these numbers
Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.
Assembly levelChromosome
08Occurrence & distribution
Record type23 797 records
Wild obs. + sensor21 206
Museum / vouchered2 564
Cultivated / captive5
Other22
Origin
Native17
Introduced3 455
Range
Area of Occupancy AOO43 160 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy58% within 1 km
≤100 m 7 246≤1 km 1 176≤10 km 5 922>10 km 247
14 591 georeferenced · 6 615 without coordinates
Open the mapobservation + sensor21 206
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy53% within 1 km
≤100 m 132≤1 km 501≤10 km 496>10 km 67
1 196 georeferenced · 1 368 without coordinates
Open the institutions mapphysical evidence2 564
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
>10 km 3
3 georeferenced · 2 without coordinates
Open the mapnot free-living5
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions131 of 212 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Berlin, DE | 140 |
| Moscow State Universitylocation not on record | 104 |
| Riverside, US | 88 |
| Santa Barbara, US | 81 |
| Claremont, US | 77 |
| Canadian Department of Agriculturelocation not on record | 74 |
| LDlocation not on record | 74 |
| MeiseBGlocation not on record | 64 |
| Mount Annan, AU | 60 |
| South Kensington, GB | 56 |
| Davis, US | 50 |
| Pullman, US | 49 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 48 |
| Bern, CH | 43 |
| Brisbane, AU | 42 |
| Bronx, US | 39 |
| Adelaide, AU | 38 |
| San Diego, US | 35 |
| Canberra, AU | 33 |
| BDBClocation not on record | 33 |
| Görlitz, DE | 31 |
| San Luis Obispo, US | 30 |
| WTUlocation not on record | 30 |
| Moscow, US | 28 |
| Arcata, US | 28 |
| Adam Mickiewicz University in Poznańlocation not on record | 27 |
| Barcelona, ES | 25 |
| València, ES | 24 |
| Corvallis, US | 24 |
| BRNUlocation not on record | 23 |
| Córdoba, AR | 22 |
| CASlocation not on record | 21 |
| Museo Entomologico de Leonlocation not on record | 21 |
| Wlocation not on record | 19 |
| Angwin, US | 19 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 19 |
| BClocation not on record | 18 |
| Mlocation not on record | 17 |
| IDElocation not on record | 16 |
| Philadelphia, US | 15 |
| Armidale, AU | 14 |
| Oskarshamn, SE | 14 |
| San Isidro, AR | 13 |
| UChlocation not on record | 13 |
| Provo, US | 12 |
| Logan, US | 12 |
| KMNlocation not on record | 11 |
| ASUlocation not on record | 11 |
| University of Stellenboschlocation not on record | 11 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 11 |
| Winterthur, CH | 11 |
| Turlock, US | 11 |
| Olocation not on record | 11 |
| Fort Worth, US | 10 |
| BSBIlocation not on record | 10 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 10 |
| UGentlocation not on record | 9 |
| BFLlocation not on record | 9 |
| Los Angeles, US | 8 |
| CICYTEXlocation not on record | 8 |
| Porrentruy, CH | 8 |
| Flagstaff, US | 8 |
| USFSlocation not on record | 8 |
| Wuzhou, CN | 8 |
| Entomological Society of Latvialocation not on record | 7 |
| Kew, GB | 7 |
| John T. Waterhouse Herbariumlocation not on record | 7 |
| MAlocation not on record | 7 |
| Irvine, US | 7 |
| Frauenfeld, CH | 6 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 6 |
| DOI/NPS, Greenbelt Parklocation not on record | 6 |
| Bozeman, US | 6 |
| Henderson, US | 6 |
| Bergen, NO | 6 |
| Northridge, US | 6 |
| Paris, FR | 6 |
| EL PASO, US | 6 |
| Phoenix, US | 6 |
| Santa Cruz, US | 5 |
| Oulu, FI | 5 |
| NSW Dept of Planning, Industry and Environmentlocation not on record | 5 |
| Denver, US | 5 |
| Dresden, DE | 5 |
| US | 5 |
| Weber State Universitylocation not on record | 5 |
| Frankfurt am Main | 4 |
| Bratislava, SK | 4 |
| Uppsala, SE | 4 |
| Walla Walla, US | 4 |
| Saint Louis, US | 4 |
| Staten Island, US | 4 |
| San Francisco, US | 4 |
| Pretoria, ZA | 4 |
| Parkville, AU | 4 |
| Salzburg, AT | 4 |
| Brussel, BE | 4 |
| Odawara, JP | 4 |
| Monastir, TN | 3 |
| Agriculture and Agri-Food Canada, Vascular Plant Herbariumlocation not on record | 3 |
| DBF-NHMDlocation not on record | 3 |
| Helsinki, FI | 3 |
| Bloomington, US | 3 |
| Austin, US | 3 |
| Auckland, NZ | 3 |
| College of the Atlantic, Museumlocation not on record | 3 |
| KNFHClocation not on record | 3 |
| Madison, US | 3 |
| Mexico City, MX | 3 |
| Dekalb, US | 3 |
| Uniwersytet Śląski w Katowicachlocation not on record | 3 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 3 |
| Laboratory of Palaeontologylocation not on record | 3 |
| Finnish Museum of Natural History, Botanical Museumlocation not on record | 3 |
| College Park, US | 3 |
| Chapel Hill, US | 3 |
| Turku, FI | 3 |
| Stockholm, SE | 3 |
| Xiamen, CN | 3 |
| GJOlocation not on record | 3 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 2 |
| Castelar, AR | 2 |
| Trondheim, NO | 2 |
| Corrientes, AR | 2 |
| Long Beach, US | 2 |
| Palmerston, AU | 2 |
| Christchurch, NZ | 2 |
| Chongqing Museumlocation not on record | 2 |
| Orem, US | 2 |
| Missoula, US | 2 |
| Granada, ES | 2 |
| Bourges, FR | 2 |
| Vitoria, ES | 2 |
| SLU Artdatabankenlocation not on record | 2 |
| Grand Junction, US | 2 |
| Institute for Biology of National Academy of Sci.location not on record | 2 |
| Bangkok, TH | 2 |
| Cheney, US | 2 |
| Columbia, US | 2 |
| Kuopio, FI | 2 |
| University of New Hampshirelocation not on record | 2 |
| Provincia di Livornolocation not on record | 2 |
| Beijing, CN | 2 |
| Ashland, US | 2 |
| Boise, US | 2 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 2 |
| Uniwersytet Warszawskilocation not on record | 2 |
| Boumlocation not on record | 2 |
| Tsukuba, JP | 2 |
| TROMlocation not on record | 2 |
| Catalina Island Conservancylocation not on record | 2 |
| Podgorica, ME | 2 |
| NSW Office of Environment and Heritagelocation not on record | 2 |
| Albuquerque, US | 2 |
| Porto Alegre, BR | 1 |
| Servico de Microbiologia e Imunologialocation not on record | 1 |
| Jackson, US | 1 |
| Montréal, CA | 1 |
| GZUlocation not on record | 1 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 1 |
| Whitewater, US | 1 |
| Severin-McDaniel Insect Collectionlocation not on record | 1 |
| US | 1 |
| Nagano City, JP | 1 |
| Córdoba, ES | 1 |
| H-Meierottlocation not on record | 1 |
| Hazara Universitylocation not on record | 1 |
| Nantes Culture Collectionlocation not on record | 1 |
| Henry Brockhouse Collectionlocation not on record | 1 |
| Arizona Western Collegelocation not on record | 1 |
| Jyväskylä, FI | 1 |
| Arizona State University Biocollectionslocation not on record | 1 |
| Edinburgh, GB | 1 |
| Universidade Federale do Rio Grande do Sullocation not on record | 1 |
| GB | 1 |
| UC Berkeley, Blue Oak Ranch Reservelocation not on record | 1 |
| Sevilla, ES | 1 |
| Musée des Confluenceslocation not on record | 1 |
| Lausanne, CH | 1 |
| ULBF-AGRlocation not on record | 1 |
| Pamplona, ES | 1 |
| PRClocation not on record | 1 |
| Tartu, EE | 1 |
| CJBGlocation not on record | 1 |
| Mississippi State, US | 1 |
| STNFlocation not on record | 1 |
| Banyoles, ES | 1 |
| Pocatello, US | 1 |
| Zürich, CH | 1 |
| US | 1 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 1 |
| Sion, CH | 1 |
| New Haven, US | 1 |
| Altos de Pipe, VE | 1 |
| Phyletisches Museum Jenalocation not on record | 1 |
| Mexico City, MX | 1 |
| Vancouver, CA | 1 |
| Eastern Nevada Landscape Coalitionlocation not on record | 1 |
| Emporia, US | 1 |
| Tacoma, US | 1 |
| Montecillo, Texcoco, MX | 1 |
| Torreón, MX | 1 |
| Hobart, AU | 1 |
| Fredericton Stock Culture Collectionlocation not on record | 1 |
| USP-IBlocation not on record | 1 |
| LfUlocation not on record | 1 |
| Salamanca, ES | 1 |
| Jena Microbial Resource Collectionlocation not on record | 1 |
| Cape Town, ZA | 1 |
| La Paz, MX | 1 |
| Kensington, AU | 1 |
| POL003location not on record | 1 |
212 institutions · 2 306 of 2 564 vouchered records shown · 258 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA23 detections
Where the DNA of Centaurea solstitialis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found23
Studies independent surveys1
Countries5
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 23 detections have coordinates
Open the map5 countries0
vegetable garden
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median11.3 °C 3.00–17.4
Seasonal swing summer↔winter22.1 °C
Max temp (day)15.1 °C 6.20–20.8
Min temp (night)8.20 °C 0.2–14.4
Precipitation75.2 mm/mo 33.5–81.4
Air humidity62.9 % 62.0–65.4
Moisture balance-1.80 mm/mo -85.4–19.0
Vapour deficit552 Pa 350–757
Wind speed4.10 m/s 2.00–5.80
Cloud cover48.0 % 31.4–57.7
CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.