Centaurea pullata
speciesAt a glance
Occurrence records6 073
Data sources14
Biological traits10
DNA specimens1
eDNA detections1
Sources14 archives
Databases and archives Centaurea pullata's data was compiled from.
WikipediaWikimedia Foundation6 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility6 073 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics1 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements2 literature sources10 traits
Chemical compositionLOTUS · NPASS46 compounds
Occurrence & distributionGBIF6 073 records
Environmental DNA1 datasets · 0 countries1 detections
DNA & barcodingBOLD · NCBI1 specimens
Genome at a glanceCCDB2n = 22
01Narrative
Centaurea pullata is a species of Centaurea found in Southwest Europe and Northwest Africa.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTTRY
Size & morphology1
Plant height0.05 m
Life cycle & reproduction3
Life spanBiennial
⚠ sources differ — TRY: Biennial · GIFT: biennial
Lifespan years3 years
Raunkiær life formhemicryptophyte
Diet & foraging1
Parasiteindependent
Habitat & environment5
Aquaticterrestrial
Climberself-supporting
Epiphyteterrestrial
Growth formherb
Woodinessnon-woody
03Chemical composition46 compounds
Compounds documented for Centaurea pullata across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Fatty aldehydes10
Germacrane sesquiterpenoids8
Eudesmane sesquiterpenoids5
Elemane sesquiterpenoids4
Fatty aldehydes $ Oxo fatty acids4
Documented compounds46 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (1R,4Z,6R,7R,11S,12S,17S)-4-ethylidene-7,12-dihydroxy-6,7-dimethyl-2,9-dioxa-14-azatricyclo[9.5.1.014,17]heptadecane-3,8-dione | present | NPASS | |
| (2R,5E)-5-ethylidene-2-hydroxy-2-methyl-3-methylidenehexanedioic acid | present | NPASS | |
| (2S,3S,5Z)-5-ethylidene-2-hydroxy-2,3-dimethylhexanedioic acid | present | NPASS | |
| (3S,3aR,4S,5aR,6R,9S,9aS,9bR)-4,6-dihydroxy-3,5a-dimethyl-2-oxo-3,3a,4,5,6,7,8,9,9a,9b-decahydrobenzo[g][1]benzofuran-9-carbaldehyde | present | LOTUS | |
| (3S,3aR,4S,5aR,9S,9aS,9bR)-4-hydroxy-3,5a-dimethyl-2-oxo-3,3a,4,5,6,7,8,9,9a,9b-decahydrobenzo[g][1]benzofuran-9-carbaldehyde | present | LOTUS | |
| (3S,3aR,4S,6E,10Z,11aR)-4-hydroxy-10-(hydroxymethyl)-3,6-dimethyl-3a,4,5,8,9,11a-hexahydro-3H-cyclodeca[b]furan-2-one | present | LOTUS | |
| (3S,3aR,4S,6E,11aR)-4-hydroxy-10-(hydroxymethyl)-3,6-dimethyl-3a,4,5,8,9,11a-hexahydro-3H-cyclodeca[b]furan-2-one | present | LOTUS | |
| (5E)-5-[(4E,6E)-nona-4,6,8-trien-2-ynylidene]-2H-furan | present | LOTUS | |
| (5E,7E)-pentadeca-5,7-dien-9,11,13-triynal | present | LOTUS | |
| (5E,7E,13E)-pentadeca-5,7,13-trien-9,11-diynal | present | LOTUS |
05DNA & barcoding1 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Centaurea pullata has left across the world's sequence archives.
At a glance
DNA specimens1
Marker genes2
GenBank sequences10
eDNA detections1
Countries1
The DNA barcodea real sequence read deposited for this species
TCGAAGCCTGCATAGCAGAACGACCCGTGAACATGTAATCTCAATCGGGCATCGTGGGATTAGGTGCGAGCCTTACCCCTGCGATGCTTG …
Centaurea pullata subsp. baetica isolate A1089 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★ITS10★ITS2
fungal barcode
06Genome at a glanceCCDB
The complete instruction manual Centaurea pullata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 22 n = 11
Ploidydiploid inferred
Chromosome records22–342n range22median22mode18records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 2217×CCDB · iber-fl · CCDB · fl-europaea · CCDB · ipcn-api-dl +3
CCDB · iber-fl — Contribution la connaissance cytotaxinomique des spermatophyta du Portugal. II. Compositae Fernandes, A. & M. Queirs.Bol. Soc. Brot. ser. 245: 5-121(1971).
CCDB · iber-fl — Estudios citogenticos en especies espaolas del gnero Centaurea. Granada. Fernndez Morales, M. J.*(1974).
CCDB · iber-fl — IOPB. Chromosome number reports. XLVI. Fernndez Morales, M. J.Taxon23(5/6): 805(1974).
CCDB · iber-fl — Chromosome numbers of plants collected during Iter Mediterraneum I in the SE of Spain. Luque, T. & Z. Daz Lifante.Bocconea1: 303-364(1991).
CCDB · iber-fl — Cytotaxonomy of spanish plants. IV.-Dicotyledons: Caesalpinacea-Asteracea. Lve, A. & E. Kjellqvist.Lagascalia4(2): 153-211(1974).
CCDB · fl-europaea — Guinochet, 1957
CCDB · ipcn-api-dl — Hellwig, F., C. Oberprieler, R. Vogt & G. Wagenitz. 1994. Chromosome numbers of north African phanerograms. III. Some counts in Centaurea (Compositae, Cardueae). Willdenowia 24: 249–254.
CCDB · ipcn-api-dl — Luque, T. & Z. D. Lifante. 1991. Chromosome numbers of plants collected during Iter Mediterraneum I in the SE of Spain. Bocconea 1: 303–364.
CCDB · book-ipcn67-71 — FERNANDES, A., & M. QUEIROS. 1971. Contribution a la connaissance cytotaxinomique des Spermatophyta du Portugal. II Compositae Bol. soc. Brot. 45 (ser. 2l: 5-122.
CCDB · book-ipcn73-74 — FERNANDEZ MORALES, M.J. 1974. In IOPB chromosome number reports XLVJ Taxon 23: 801-812. I
CCDB · book-ipcn73-74 — LOEVE, A., & E. KJELLQVIST. 1974. Cytotaxonomy of Spanish plants. IV. Dicotyledons: Caesalpiniaceae- Asteraceae. Lagascalia 4: 153-211.
CCDB · CromoCat 2015 — Hellwig, F., Oberprieler, C., Vogt, & Wagenitz, G. (1994). Chromosome numbers of north African phanerograms. III. Some counts in Centaurea (Compositae, Cardueae). Willdenowia 24: 249–254.
CCDB · CromoCat 2015 — Fernandes, A. & Queirós, M. (1971a). Contribution à la connaissance cytotaxinomique des spermatophyta du Portugal. II. Compositae. Bol. Soc. Brot. 45: 5-122.
CCDB · CromoCat 2015 — Fernández Morales, M. J. (1974a). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports XLVI]. Taxon 23(5/6): 805.
CCDB · CromoCat 2015 — Fernández Morales, M. J. (1974b). Estudios citogenéticos en especies españolas del género Centaurea. Granada
CCDB · CromoCat 2015 — Löve, A. & Kjellqvist, E. (1974b). Cytotaxonomy of Spanish plants. IV.-Dicotyledons: Caesalpinaceae-Asteraceae. Lagascalia 4(2): 153-211.
CCDB · CromoCat 2015 — Luque, T. & Díaz Lifante, Z. (1991). Chromosome numbers of plants collected during Iter Mediterraneum I in the SE of Spain. Bocconea 1: 303-364.
2n 01×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Humphries, C. J., Murray, B. G., Bocquet, G. & Vasudevan, K. N. (1978). Chromosome numbers of phanerogams from Morocco and Algeria. Bot. Not. 131(4): 391-404.
2n 341×CCDB · iber-fl
CCDB · iber-fl — Chromosomenzahlen aus der Tribus Cardueae (Compositae). Hellwig, H. Frank.Willdenowia24: 219-248(1994).
n 1112×CCDB · iber-fl · CCDB · ipcn-api-dl · CCDB · book-ipcn73-74 +1
CCDB · iber-fl — Estudios citogenticos en especies espaolas del gnero Centaurea. Granada. Fernndez Morales, M. J.*(1974).
CCDB · iber-fl — IOPB. Chromosome number reports. XLVI. Fernndez Morales, M. J.Taxon23(5/6): 805(1974).
CCDB · iber-fl — Nmeros cromosmicos para la flora espaola, 104-109. Ubera, J. L.Lagascalia9(1): 123-125(1979).
CCDB · ipcn-api-dl — Ubera, J. L. 1979. In Numeros cromosomicos para la flora Espahola. 84-120. Lagascalia 9:115–130.
CCDB · ipcn-api-dl — Humphries, C. J., B. G. Murray, G. Bocquet & K. N. Vasudevan. 1978. Chromosome numbers of phanerogams from Morocco and Algeria. Bot. Not. 131: 391–404.
CCDB · ipcn-api-dl — Talavera, S., J. A. Devesa & E. F. Galiano. 1984. Notas cariosistemáticas sobre plantas norteafricanas. I. Compositae. Candollea 39: 271–280.
CCDB · book-ipcn73-74 — FERNANDEZ MORALES, M.J. 1974. In IOPB chromosome number reports XLVJ Taxon 23: 801-812. I
CCDB · CromoCat 2015 — Fernández Morales, M. J. (1974a). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports XLVI]. Taxon 23(5/6): 805.
CCDB · CromoCat 2015 — Fernández Morales, M. J. (1974b). Estudios citogenéticos en especies españolas del género Centaurea. Granada
CCDB · CromoCat 2015 — Ubera, J. L. (1979). Números cromosómicos para la flora española, 104-109. Lagascalia 9(1): 123-125.
CCDB · CromoCat 2015 — Humphries, C. J., Murray, B. G., Bocquet, G. & Vasudevan, K. N. (1978). Chromosome numbers of phanerogams from Morocco and Algeria. Bot. Not. 131(4): 391-404.
CCDB · CromoCat 2015 — Talavera, S., J. A. Devesa & E. F. Galiano. (1984). Notas cariosistemáticas sobre plantas norteafricanas. I. Compositae. Candollea 39: 271-280.
n 01×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Hellwig, F., Oberprieler, C., Vogt, & Wagenitz, G. (1994). Chromosome numbers of north African phanerograms. III. Some counts in Centaurea (Compositae, Cardueae). Willdenowia 24: 249–254.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=0.980 ↗
08Occurrence & distribution
Record type6 073 records
Wild obs. + sensor5 572
Museum / vouchered501
Origin
Native332
Range
Area of Occupancy AOO11 164 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy79% within 1 km
≤100 m 2 287≤1 km 663≤10 km 644>10 km 123
3 717 georeferenced · 1 855 without coordinates
Open the mapobservation + sensor5 572
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy56% within 1 km
≤100 m 19≤1 km 143≤10 km 125>10 km 3
290 georeferenced · 211 without coordinates
Open the institutions mapphysical evidence501
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions23 of 39 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| BClocation not on record | 73 |
| València, ES | 68 |
| ISAlocation not on record | 48 |
| CICYTEXlocation not on record | 41 |
| Córdoba, ES | 30 |
| MAlocation not on record | 25 |
| Sevilla, ES | 18 |
| Entomological Society of Latvialocation not on record | 15 |
| Madrid, ES | 14 |
| College of the Atlantic, Museumlocation not on record | 14 |
| Granada, ES | 13 |
| Barcelona, ES | 12 |
| Wlocation not on record | 12 |
| Jaén, ES | 11 |
| Alicante, ES | 11 |
| LDlocation not on record | 11 |
| Salamanca, ES | 8 |
| Saint Louis, US | 8 |
| Kew, GB | 6 |
| Coimbra, PT | 6 |
| Bronx, US | 5 |
| Phyletisches Museum Jenalocation not on record | 5 |
| Vitoria, ES | 4 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 4 |
| Henry Brockhouse Collectionlocation not on record | 3 |
| MeiseBGlocation not on record | 3 |
| Badajoz, ES | 3 |
| Paris, FR | 3 |
| Museo della Bonifica di San Donà di Piavelocation not on record | 3 |
| EEZA-CSIClocation not on record | 2 |
| Museo Achille Folettolocation not on record | 2 |
| Dekalb, US | 1 |
| Berlin, DE | 1 |
| Pamplona, ES | 1 |
| Xiamen, CN | 1 |
| Frankfurt am Main | 1 |
| Stockholm, SE | 1 |
| Adam Mickiewicz University in Poznańlocation not on record | 1 |
| Edinburgh, GB | 1 |
39 institutions · 489 of 501 vouchered records shown · 12 without an institution code
09Environmental DNA1 detections
Where the DNA of Centaurea pullata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found1
Studies independent surveys1
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 1 detections have coordinates
Open the map0 countries0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.