Centaurea paniculata

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Centaurea

At a glance

Occurrence records10 106

Data sources9

Biological traits19

DNA specimens1

eDNA detections0

Sources9 archives

Databases and archives Centaurea paniculata's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility10 106 records↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

Paleobiology DatabasePBDB consortiumfossil record↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements5 literature sources19 traits

Chemical compositionLOTUS9 compounds

Occurrence & distributionGBIF10 106 records

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 18

01Narrative

La Centaurée à panicule, ou Centaurea paniculata, est une espèce de plante à fleurs du genre Centaurea et de la famille des astéracées.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesTRYAusTraitsLEDAGIFTWCVP

Size & morphology5

Fruit length2.75 mm

Leaf length60 mm

Leaf width6 mm

Plant height0.8 m

⚠ sources differ — AusTraits: 0.8 m · TRY: 0.475 m

Plant height max0.8 m

Life cycle & reproduction4

Deciduousnessaestival

Life spanstrict monocarpic bi-annuals and poly-annuals

⚠ sources differ — TRY: strict monocarpic bi-annuals and poly-annuals · AusTraits: biennial · LEDA: strict monocarpic bi-annuals and poly-annuals · GIFT: biennial

Lifeform raunkiaer detailedhemicryptophyte

Lifespan years2 years

Habitat & environment7

Climatetemperate

Climberself-supporting

Fruit typeachene

Growth formherb

Leaf compoundnesssimple

Leaf shapelanceolate oblanceolate

Woodinessnon-woody

Physiology & chemistry2

Photosynthetic pathwayC3

Seed longevity index0

Other traits1

Plant support typefree-standing

03Chemical composition9 compounds

Compounds documented for Centaurea paniculata across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Elemane sesquiterpenoids2

Ursane and Taraxastane triterpenoids2

Germacrane sesquiterpenoids2

Stigmastane steroids1

Flavones1

Documented compounds9 total

Compound	Amount	Source
(3aR,4S,6E,10Z,11aR)-3a,4,5,8,9,11a-Hexahydro-4-hydroxy-10-(hydroxymethyl)-6-methyl-3-methylenecyclodeca(b)furan-2(3H)-one	present	LOTUS
(3S,4aR,6aR,6aR,6bR,8aR,12S,12aS,14aR,14bR)-4,4,6a,6b,8a,12,14b-heptamethyl-11-methylidene-1,2,3,4a,5,6,6a,7,8,9,10,12,12a,13,14,14a-hexadecahydropicen-3-ol	present	LOTUS
[(3aR,4R,6S,7S,7aR)-6-ethenyl-6-methyl-3-methylidene-2-oxo-7-prop-1-en-2-yl-4,5,7,7a-tetrahydro-3aH-1-benzofuran-4-yl] acetate	present	LOTUS
beta-Sitosterol	present	LOTUS
Cirsimaritin	present	LOTUS
Cnicin	present	LOTUS
Elemanolide	present	LOTUS
Stigmasterol	present	LOTUS
Taraxasterol	present	LOTUS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Centaurea paniculata has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes3

GenBank sequences10

Countries2

The DNA barcodea real sequence read deposited for this species

ITSMG243476.1 ↗546 bp

ACGT

ACATGTAATCACAACCGGGTGTCGTGGGGGTCGGGTGCGAGCCTTAGCCCTGCGATGCTCGCCGGCATGCGTTCAAGGTGGCTTTCTCTA …

Centaurea paniculata subsp. paniculata voucher UNEX:34481 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

matK6rbcL1ITS3

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Centaurea paniculata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidydiploid inferred

Chromosome records18–182n range18median18mode15records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 1815×CCDB · ita-fl · CCDB · iber-fl · CCDB · fl-europaea +4

CCDB · ita-fl — GARDOU C. - 1972. Recherches biosystmatiques sur la section Jacea Cass. et quelques sections voisines du genre Centaurea L. en France et dans les rgions limitrophes.. Feddes Repert. , 83(5-6): 311-472.

CCDB · iber-fl — Planes de recuperacin de especies vegetales amenazadas en el parque natural de la sierra de Grazalema (Cdiz-Mlaga). Aparicio, A.Acta Bot. Malacitana18: 199-221(1993).

CCDB · fl-europaea — Gardou, 1972

CCDB · ipcn-api-dl — Natarajan, G. 1981. In Chromosome number reports LXXII. Taxon 30: 698–699.

CCDB · ipcn-api-dl — Kiehn, M., E. Vitek & C. Dobea. 2000. In C. Dobea & E. Vitek, Documented Chromosome Number Checklist of Austrian Vascular Plants. Verlag des Naturhistorischen Museums Wien, Vienna.

CCDB · ipcn-api-dl — Natarajan, G. 1988. étude caryosystiématique de quelques dicotyledones de la Garrigue Languedocienne. Nat. Monspel. 52: 85–123.

CCDB · ipcn-api-dl — Aparicio Martínez, A. 1993. Planes de recuperación de especies vegetales amenazadas en el Parque Natural de la Sierra de Grazalema (Cádiz-Malaga). Acta Bot. Malac. 18: 199–221.

CCDB · book-ipcn67-71 — FERNANDES, A., & M. QUEIROS. 1971. Contribution a la connaissance cytotaxinomique des Spermatophyta du Portugal. II Compositae Bol. soc. Brot. 45 (ser. 2l: 5-122.

CCDB · book-ipcn75-78 — Loon & Jong 1978

CCDB · CromoCat 2015 — Kiehn, M., Vitek, E. & Dobeš, C. (2000). In C. Dobeš & E. Vitek, Documented Chromosome Number Checklist of Austrian Vascular Plants. Verlag des Naturhistorischen Museums Wien, Vienn

CCDB · CromoCat 2015 — Loon van, J. C. & de Jong, H. (1978). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LIX]. Taxon 27(1): 56-61.

CCDB · CromoCat 2015 — Natarajan, G. (1981). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXXII]. Taxon 30(3): 698-699.

CCDB · CromoCat 2015 — Natarajan, G. (1988). Étude caryosystiématique de quelques dicotyledones de la Garrigue Languedocienne. Naturalia Monspel., Sér. Bot. 52: 85-123.

CCDB · CromoCat 2015 — Fernandes, A. & Queirós, M. (1971a). Contribution à la connaissance cytotaxinomique des spermatophyta du Portugal. II. Compositae. Bol. Soc. Brot. 45: 5-122.

CCDB · CromoCat 2015 — Queirós, M. (1973b). Contribuiçao para o conhecimento citotaxonómico das Spermatophyta de Portugal. II. Compositae, supl. 1. Bol. Soc. Brot. 47: 299-314.

2n 191×CCDB · fl-europaea

CCDB · fl-europaea — Guinochet, 1957

n 01×CCDB · CromoCat 2015

CCDB · CromoCat 2015 — Kiehn, M., Vitek, E. & Dobeš, C. (2000). In C. Dobeš & E. Vitek, Documented Chromosome Number Checklist of Austrian Vascular Plants. Verlag des Naturhistorischen Museums Wien, Vienn

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type10 106 records

Wild obs. + sensor9 623

Museum / vouchered329

Other154

Origin

Introduced34

Range

Area of Occupancy AOO9 404 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy12% within 1 km

≤100 m 818≤1 km 231≤10 km 7 853>10 km 45

8 947 georeferenced · 676 without coordinates

Open the mapobservation + sensor9 623

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy58% within 1 km

≤100 m 17≤1 km 60≤10 km 49>10 km 6

132 georeferenced · 197 without coordinates

Open the institutions mapphysical evidence329

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions34 of 55 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Institut und Museum fuer Geologie und Palaeontologielocation not on record	49
CICYTEXlocation not on record	33
BClocation not on record	33
MAlocation not on record	23
BDBClocation not on record	16
Entomological Society of Latvialocation not on record	15
Vitoria, ES	14
Barcelona, ES	10
Zürich, CH	9
Görlitz, DE	8
València, ES	6
Porrentruy, CH	6
Salamanca, ES	6
Monastir, TN	5
Victoria, CA	5
Wlocation not on record	4
Alicante, ES	4
Museo Entomologico de Leonlocation not on record	4
Madrid, ES	3
Universidad del Pais Vasco (UPV/EHU)location not on record	3
LDlocation not on record	3
Muséum Henri Lecoqlocation not on record	3
Paris, FR	3
South Kensington, GB	3
Moscow, US	3
Université Lavallocation not on record	3
Bourges, FR	2
Oulu, FI	2
Adelaide, AU	2
Adam Mickiewicz University in Poznańlocation not on record	2
San Sebastián, ES	2
Oskarshamn, SE	2
Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record	2
Granada, ES	2
Karlsruhe, DE	2
BRNUlocation not on record	1
Sevilla, ES	1
Badajoz, ES	1
Uniwersytet Śląski w Katowicachlocation not on record	1
Hobart, AU	1
Musée des Confluenceslocation not on record	1
Berlin, DE	1
Gijón, ES	1
College of the Atlantic, Museumlocation not on record	1
Zürich, CH	1
IDElocation not on record	1
Pamplona, ES	1
Podgorica, ME	1
GJOlocation not on record	1
Museo Achille Folettolocation not on record	1
EL PASO, US	1
Frankfurt am Main	1
Santiago de Compostela, ES	1
New Brunswick, US	1
Philadelphia, US	1

55 institutions · 312 of 329 vouchered records shown · 17 without an institution code

At a glance

Sources9 archives

Size & morphology5

Life cycle & reproduction4

Habitat & environment7

Physiology & chemistry2

Other traits1

Compound class profile5 classes

Documented compounds9 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type10 106 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions34 of 55 geolocated

Record type10 106 records