Centaurea nigrescens
Willd. · speciesAt a glance
Occurrence records4 059
Data sources12
Biological traits36
DNA specimens15
eDNA detections8
Sources12 archives
Databases and archives Centaurea nigrescens's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility4 059 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics15 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources36 traits
Chemical compositionLOTUS · NPASS148 compounds
Occurrence & distributionGBIF4 059 records
Environmental DNA1 datasets · 1 countries8 detections
DNA & barcodingBOLD · NCBI15 specimens
Genome at a glanceCCDB2n = 44
01Narrative
La centaurée noirâtre ou centaurée noircissante (Centaurea nigrescens) est une espèce de plante à fleurs de la famille des Astéracées. Ce sont des plantes herbacées vivaces.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTAusTraitsLEDATRYWCVP
Size & morphology9
Fruit length3 mm
Leaf length35 mm
Plant height0.8 m
⚠ sources differ — GIFT: 0.8 m · AusTraits: 1 m · LEDA: 0.6 m · TRY: 1 m
Plant height generative0.65 m
Plant height max0.8 m
Plant height min0.2 m
Seed mass2.61 mg
⚠ sources differ — TRY: 2.61 mg · LEDA: 1.47 mg · GIFT: 2.04 mg
Seed mass max2.61 mg
Seed mass min2.61 mg
Life cycle & reproduction10
Deciduousnessaestival
⚠ sources differ — TRY: aestival · GIFT: deciduous
Dispersal typehuman
Flowering endJul
Flowering startAug
Life formperennial
Life spanperennial
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formhemicryptophyte
Self fertilizationpresent
Diet & foraging1
Parasiteindependent
Habitat & environment10
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max500 m
Elevation min0 m
Epiphyteterrestrial
Fruit typeachene
Growth formherb
Leaf shapelanceolate
Woodinessnon-woody
Physiology & chemistry5
Leaf C:N ratio23.44 g/g
Leaf c447 mg/g
Leaf dry-matter content (LDMC)181 mg/g
Leaf n19.1 mg/g
Photosynthetic pathwayC3
Other traits1
Diaspore typegerminule
03Chemical composition148 compounds
Compounds documented for Centaurea nigrescens across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Gallotannins39
Flavones7
Piperidine alkaloids5
Ursane and Taraxastane triterpenoids5
Stigmastane steroids4
Documented compounds148 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (+)-Ursolic Acid | present | NPASS | |
| (10R,11R)-10-[(14R,15S,19R)-2,3,4,7,8,9,19-heptahydroxy-12,17-dioxo-13,16-dioxatetracyclo[13.3.1.05,18.06,11]nonadeca-1,3,5(18),6,8,10-hexaen-14-yl]-3,4,5,11,17,18,19,22,23,34,35-undecahydroxy-9,13,25,32-tetraoxaheptacyclo[25.8.0.02,7.015,20.021,30.024,29.028,33]pentatriaconta-1(35),2,4,6,15,17,19,21,23,27,29,33-dodecaene-8,14,26,31-tetrone | present | NPASS | |
| (10R,11R)-10-[(14S,15S,19R)-2,3,4,7,8,9,19-heptahydroxy-12,17-dioxo-13,16-dioxatetracyclo[13.3.1.05,18.06,11]nonadeca-1,3,5(18),6,8,10-hexaen-14-yl]-3,4,5,11,16,17,18,21,22,33,34-undecahydroxy-9,24,31-trioxaheptacyclo[24.8.0.02,7.014,19.020,29.023,28.027,32]tetratriaconta-1(34),2,4,6,14,16,18,20,22,26,28,32-dodecaene-8,13,25,30-tetrone | present | NPASS | |
| (10R,11R,13R,14R,15S)-3,4,5,11,14,20,21,22-octahydroxy-13-(hydroxymethyl)-9,12,16-trioxatetracyclo[16.4.0.02,7.010,15]docosa-1(22),2,4,6,18,20-hexaene-8,17-dione | present | NPASS | |
| (1R,2S,4aS,6aR,6aS,6bS,8aS,10S,12aR,14bR)-10-hydroxy-1,2,6a,6b,9,9,12a-heptamethyl-2,3,4,5,6,6a,7,8,8a,10,11,12,13,14b-tetradecahydro-1H-picene-4a-carboxylic acid | present | NPASS | |
| (1R,2S,8R,10R,19R,20S,39S)-8,9,9,13,14,25,26,27,30,31,32,39-dodecahydroxy-3,18,21,36,38,40-hexaoxaoctacyclo[18.17.1.12,19.18,12.05,10.011,16.023,28.029,34]tetraconta-5,11,13,15,23,25,27,29,31,33-decaene-4,7,17,22,35-pentone | present | NPASS | |
| (1S,2R,4aS,6aR,6aS,6bR,8aS,9R,10R,11R,12aR,14bS)-10,11-dihydroxy-9-(hydroxymethyl)-1,2,6a,6b,9,12a-hexamethyl-2,3,4,5,6,6a,7,8,8a,10,11,12,13,14b-tetradecahydro-1H-picene-4a-carboxylic acid | present | NPASS | |
| (2S)-2,5,7-trihydroxy-2-(4-hydroxyphenyl)-4H-chromen-3-one | present | NPASS | |
| (2S)-2-(2,5-dihydroxy-4-methoxyphenyl)-5,6,8-trihydroxy-7-[(2S,3R,4S,5R)-3,4,5-trihydroxyoxan-2-yl]oxy-2,3-dihydrochromen-4-one | present | NPASS | |
| (2S)-5,6,7,8-tetrahydroxy-2-(2,3,5-trihydroxy-4-methoxyphenyl)-2,3-dihydrochromen-4-one | present | NPASS |
05DNA & barcoding15 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Centaurea nigrescens has left across the world's sequence archives.
At a glance
DNA specimens15
Marker genes5
GenBank sequences10
eDNA detections8
Countries3
The DNA barcodea real sequence read deposited for this species
TGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATTCGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATC …
Centaurea nigrescens voucher CCDB-22989-D03 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK1★rbcL5★rbcLa★ITS4★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB
The complete instruction manual Centaurea nigrescens carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 44 n = 22
Ploidypolyploid inferred
Chromosome records22–442n range44median44mode14records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 4412×CCDB · ita-fl · CCDB · ipcn-api-dl · CCDB · book-ipcn72 +4
CCDB · ita-fl — GARDOU C. - 1972. Recherches biosystmatiques sur la section Jacea Cass. et quelques sections voisines du genre Centaurea L. en France et dans les rgions limitrophes.. Feddes Repert. , 83(5-6): 311-472.
CCDB · ipcn-api-dl — Kuzmanov, B. A., S. B. Georgieva & V. A. Nikolova. 1986. Chromosome numbers of Bulgarian flowering plants. I. Fam. Asteraceae. Fitologija 31: 71–74.
CCDB · ipcn-api-dl — Tonian, T. R. 1980. Relation between chromosome number and some morphological features of Centaureinae Less representatives. Rev. Biol. 33 (5): 552–554.
CCDB · ipcn-api-dl — Bancheva, S. & J. Greilhuber. 2006. Genome size in Bulgarian Centaurea s.l. (Asteraceae). Pl. Syst. Evol. 257: 95–117.
CCDB · ipcn-api-dl — Lovric, A. Z. 1982. In IOPB chromosome number reports LXXVII. Taxon 31: 762–763.
CCDB · book-ipcn72 — GARDOU, c. 1972. Recherches biosystematiques sur la Section Jacea Cass. et quelques sections voisines du genre Centaurea L. en France et dans les regions limitrophes. Feddes Repert. 83: 311-472.
CCDB · book-ipcn67-71 — TONJAN, Z.R. 1968. The chromosome numbers of some species of the genus Centaurea. (In Russian) Biol. Zurn. Arm. S.S.R. 21: 86-96.
CCDB · kew — Siljak-Yakovlev S, Pustahija F, Šolic EM, Bogunic F, Muratovic E, Bašic N, Catrice O, Brown SC. 2010. Towards a genome size and chromosome number database of Balkan flora: C-values in 343 taxa with novel values for 242. Advanced Science Letters 3: 190-213
CCDB · kew — Bancheva S, Greilhuber J. 2006. Genome size in Bulgarian Centaurea s.l. (Asteraceae). Plant Systematics and Evolution 257: 95-117.
CCDB · Cave1956 — Gninoohet a
CCDB · Cave1962 — Guinochet & F. 1962
2n 222×CCDB · ipcn-api-dl · CCDB · eflora
CCDB · ipcn-api-dl — Dobea, C. & B. Hahn. 1997. IOPB chromosome data 11. Newslett. Int. Organ. Pl. Biosyst. (Oslo) 26/27: 15–18.
CCDB · eflora
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type4 059 records
Wild obs. + sensor3 651
Museum / vouchered400
Other8
Range
Area of Occupancy AOO8 888 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy47% within 1 km
≤100 m 1 189≤1 km 283≤10 km 1 598>10 km 49
3 119 georeferenced · 532 without coordinates
Open the mapobservation + sensor3 651
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy44% within 1 km
≤100 m 30≤1 km 59≤10 km 100>10 km 14
203 georeferenced · 197 without coordinates
Open the institutions mapphysical evidence400
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions49 of 84 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| LDlocation not on record | 28 |
| Bern, CH | 21 |
| Wlocation not on record | 20 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 19 |
| Chongqing Museumlocation not on record | 19 |
| IDElocation not on record | 18 |
| Mlocation not on record | 17 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 13 |
| Görlitz, DE | 11 |
| Montréal, CA | 9 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 9 |
| Salzburg, AT | 9 |
| BRNUlocation not on record | 8 |
| Ann Arbor, US | 8 |
| Pullman, US | 7 |
| McWane Science Centerlocation not on record | 7 |
| Philadelphia, US | 7 |
| Oskarshamn, SE | 7 |
| MeiseBGlocation not on record | 6 |
| Fairfax, US | 6 |
| BClocation not on record | 5 |
| Bronx, US | 5 |
| Berlin, DE | 5 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 5 |
| Bourges, FR | 4 |
| New Haven, US | 4 |
| University of Stellenboschlocation not on record | 4 |
| BIO-UNIPIlocation not on record | 4 |
| New Brunswick, US | 4 |
| Provincia di Livornolocation not on record | 4 |
| GJOlocation not on record | 3 |
| Burlington, US | 3 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 3 |
| Canadian Department of Agriculturelocation not on record | 3 |
| Zürich, CH | 3 |
| St. Paul, US | 3 |
| Bloomington, US | 3 |
| Wuzhou, CN | 2 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 2 |
| San Luis Obispo, US | 2 |
| Porrentruy, CH | 2 |
| Fulda, DE | 2 |
| Vancouver, CA | 2 |
| Frankfurt am Main | 2 |
| Adam Mickiewicz University in Poznańlocation not on record | 2 |
| San Isidro, AR | 2 |
| Mohonk Preservelocation not on record | 2 |
| GZUlocation not on record | 2 |
| Adelaide, AU | 2 |
| Morgantown, US | 2 |
| BFLlocation not on record | 2 |
| Uppsala, SE | 2 |
| Staten Island, US | 2 |
| València, ES | 2 |
| Columbia, US | 1 |
| Acadia Universitylocation not on record | 1 |
| Riverside, US | 1 |
| Davis, US | 1 |
| Frauenfeld, CH | 1 |
| Chapel Hill, US | 1 |
| Royal Ontario Museum, Green Plant Herbarium (TRT)location not on record | 1 |
| Millersville, US | 1 |
| Zürich, CH | 1 |
| Madison, US | 1 |
| Museum of the Rockieslocation not on record | 1 |
| Oswego, US | 1 |
| WTUlocation not on record | 1 |
| Dhaka, BD | 1 |
| Fribourg, CH | 1 |
| Moscow State Universitylocation not on record | 1 |
| University of Guelph, OAC Herbariumlocation not on record | 1 |
| Tacoma, US | 1 |
| Asheville, US | 1 |
| Corvallis, US | 1 |
| No collectionlocation not on record | 1 |
| Philadelphia, US | 1 |
| Bangkok, TH | 1 |
| Toronto, CA | 1 |
| Saint Louis, US | 1 |
| University of New Hampshirelocation not on record | 1 |
| USFS/BHSClocation not on record | 1 |
| LINUlocation not on record | 1 |
| Williamsburg, US | 1 |
| Museo Entomologico de Leonlocation not on record | 1 |
84 institutions · 378 of 400 vouchered records shown · 22 without an institution code
09Environmental DNA8 detections
Where the DNA of Centaurea nigrescens was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found8
Studies independent surveys1
Countries1
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 8 detections have coordinates
Open the map1 country0
dry gravel and sand at roadside under hydrol…Roadside.
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median18.5 °C 17.6–19.3
Seasonal swing summer↔winter27.9 °C
Max temp (day)23.5 °C 22.5–24.5
Min temp (night)14.8 °C 14.3–15.3
Precipitation82.6 mm/mo 81.6–83.6
Air humidity60.0 % 59.3–60.7
Moisture balance-40.6 mm/mo -48.9–-32.2
Vapour deficit854 Pa 792–916
Wind speed2.80 m/s 2.50–3.20
Cloud cover41.3 % 40.9–41.7
CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.