Centaurea nervosa

Willd. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Centaurea

At a glance

Occurrence records6 538

Data sources10

Biological traits22

DNA specimens4

eDNA detections2

Sources10 archives

Databases and archives Centaurea nervosa's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility6 538 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources22 traits

Chemical compositionNPASS7 compounds

Occurrence & distributionGBIF6 538 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI4 specimens

Genome at a glanceCCDB2n = 22

01Narrative

Il fiordaliso alpino è una pianta erbacea, angiosperma dicotiledone, appartenente alla famiglia delle Asteraceae.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology6

Plant height0.215 m

Plant height generative0.251 m

Plant height max0.4 m

Plant height min0.1 m

Seed length4 mm

Seed mass3.52 mg

Life cycle & reproduction5

Flowering endAug

Flowering startJul

Life spanperennial

Lifespan years5 years

Raunkiær life formhemicryptophyte

Habitat & environment4

Aquaticterrestrial

Climatetemperate

Growth formherb

Woodinessnon-woody

Physiology & chemistry6

Leaf C:N ratio16.85 g/g

Leaf c440 mg/g

Leaf dry-matter content (LDMC)160 mg/g

Leaf n25.41 mg/g

Leaf p1.77 mg/g

Photosynthetic pathwayC3

Other traits1

Diaspore typefruit

03Chemical composition7 compounds

Compounds documented for Centaurea nervosa across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Flavones7

Documented compounds7 total

Tissue Source Quantified only

Compound	Amount	Source
2-(3,4-dihydroxyphenyl)-5,7-dihydroxy-6-[(2R,3R,4R,5S,6R)-3,4,5-trihydroxy-6-[[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxymethyl]oxan-2-yl]chromen-4-one	present	NPASS
[(2R,3S,4R,5R,6S)-6-[2-(3,4-dihydroxyphenyl)-5,7-dihydroxy-4-oxochromen-6-yl]-3,4,5-trihydroxyoxan-2-yl]methyl (E)-3-(3,4-dihydroxyphenyl)prop-2-enoate	present	NPASS
Isoorientin 6-O''-beta-D-glucopyranoside	present	NPASS
Isoorientin 7-O-(6'''-O-(E)-feruloyl)glucoside	present	NPASS
Isovitexin	present	NPASS
Isovitexin 6''-O-Glucoside	present	NPASS
Luteolin 7-glucoside	present	NPASS

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Centaurea nervosa has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes2

GenBank sequences3

eDNA detections2

Countries4

The DNA barcodea real sequence read deposited for this species

ITSKF721050.1 ↗628 bpFrance

ACGT

TCGAAGCCTGCACAGCAGAACGACCCGTGAACATGTAATCACAACCGGGTGTCGTGGGATTGGGTGCGAGCCTTAGCCCTGCGATGCTCG …

Centaurea nervosa subsp. nervosa voucher Chanousia Botanical Gardens internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL★ITS3

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Centaurea nervosa carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidydiploid inferred

Chromosome records22–442n range22median22mode14records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 2211×CCDB · ita-fl · CCDB · fl-europaea · CCDB · ipcn-api-dl +3

CCDB · ita-fl — GARDOU C. - 1972. Recherches biosystmatiques sur la section Jacea Cass. et quelques sections voisines du genre Centaurea L. en France et dans les rgions limitrophes.. Feddes Repert. , 83(5-6): 311-472.

CCDB · ita-fl — GADELLA T.W.J., KLIPHUIS E. - 1970. Cytotaxonomic investigations in some Angiosperms collected in the valley of Aosta and in the National Park Gran Paradiso.. Caryologia , 23(3): 363-379.

CCDB · fl-europaea — Gardou, 1972

CCDB · ipcn-api-dl — Kuzmanov, B. & S. Georgieva. 1983. In: IOPB chromosome number reports LXXXI. Taxon 32: 665.

CCDB · ipcn-api-dl — Baltisberger, M. 1993. Zytologische Untersuchungen an Compositen aus Albanien. Candollea 48(2): 437–448.

CCDB · ipcn-api-dl — Huber, W. & M. Baltisberger. 1992. IOPB chromosome data 4. Int. Organ. Pl. Biosyst. Newslett. (Zurich) 18/19: 6–8.

CCDB · ipcn-api-dl — Bancheva, S. & J. Greilhuber. 2006. Genome size in Bulgarian Centaurea s.l. (Asteraceae). Pl. Syst. Evol. 257: 95–117.

CCDB · book-ipcn72 — GARDOU, c. 1972. Recherches biosystematiques sur la Section Jacea Cass. et quelques sections voisines du genre Centaurea L. en France et dans les regions limitrophes. Feddes Repert. 83: 311-472.

CCDB · book-ipcn67-71 — GADELLA, TH. W.J., & E. KLIPHUIS. 1970. Cytotaxonomic investigations in some angiosperms collected in the Valley of Aosta and in the National Park "Gran Paradiso". Carylogia 23: 363-379.

CCDB · book-atlas-flowering-plants — Favarger 1953

2n 443×CCDB · ipcn-api-dl · CCDB · kew

CCDB · ipcn-api-dl — Bancheva, S. T. 1998. Mediterranean chromosome number reports 8 (970--976). Fl. Medit. 8: 273–280.

CCDB · ipcn-api-dl — Bancheva, S. & J. Greilhuber. 2006. Genome size in Bulgarian Centaurea s.l. (Asteraceae). Pl. Syst. Evol. 257: 95–117.

CCDB · kew — Bancheva S, Greilhuber J. 2006. Genome size in Bulgarian Centaurea s.l. (Asteraceae). Plant Systematics and Evolution 257: 95-117.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=0.976 ↗

08Occurrence & distribution

Record type6 538 records

Wild obs. + sensor6 210

Museum / vouchered326

Other2

Range

Area of Occupancy AOO6 788 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy31% within 1 km

≤100 m 1 495≤1 km 323≤10 km 3 878>10 km 149

5 845 georeferenced · 365 without coordinates

Open the mapobservation + sensor6 210

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy42% within 1 km

≤100 m 8≤1 km 89≤10 km 134>10 km 1

232 georeferenced · 94 without coordinates

Open the institutions mapphysical evidence326

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 23 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Zürich, CH	95
Zürich, CH	78
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	34
Bern, CH	25
GJOlocation not on record	18
Institut und Museum fuer Geologie und Palaeontologielocation not on record	10
Görlitz, DE	9
BRNUlocation not on record	7
Adam Mickiewicz University in Poznańlocation not on record	7
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	6
Berlin, DE	5
LDlocation not on record	4
Moscow State Universitylocation not on record	3
BG-NMNHSlocation not on record	3
Dresden, DE	2
GZUlocation not on record	2
Wlocation not on record	2
Frankfurt am Main	2
CJBGlocation not on record	1
MAlocation not on record	1
National Museum of Natural History, Bulgarian Academy of Scienceslocation not on record	1
Bourges, FR	1
Monastir, TN	1

23 institutions · 317 of 326 vouchered records shown · 9 without an institution code

09Environmental DNA2 detections

Where the DNA of Centaurea nervosa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Centaurea nervosa

At a glance

Sources10 archives

Size & morphology6

Life cycle & reproduction5

Habitat & environment4

Physiology & chemistry6

Other traits1

Compound class profile1 class

Documented compounds7 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type6 538 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions9 of 23 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type6 538 records