Centaurea melitensis

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Centaurea

At a glance

Occurrence records28 035

Data sources15

Biological traits63

DNA specimens45

eDNA detections17

Sources15 archives

Databases and archives Centaurea melitensis's data was compiled from.

WikipediaWikimedia Foundation8 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility28 035 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI17 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics45 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

giftgenome & karyotype

PloiDBPloidy Databasegenome & karyotype

Paleobiology DatabasePBDB consortiumfossil record↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements5 literature sources63 traits

Chemical compositionLOTUS · NPASS30 compounds

Occurrence & distributionGBIF28 035 records

Environmental DNA1 datasets · 5 countries17 detections

DNA & barcodingBOLD · NCBI45 specimens

Genome at a glanceCCDB · GIFT914 Mbp

01Narrative

Centaurea melitensis (called Maltese star-thistle in Europe, tocalote or tocolote in western North America) is an annual plant in the family Asteraceae, 1 to high, with resin-dotted leaves and spine-tipped phyllaries. This plant is native to the Mediterranean region of Europe and Africa. It was introduced to North America in the 18th century; the first documented occurrence in California is in the adobe of a building constructed in San Fernando in 1797. It is also naturalized on a number of Pacific islands.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesTRYAusTraitsLEDAGIFTWCVP

Size & morphology21

Fruit length2.5 mm

⚠ sources differ — AusTraits: 2.5 mm · GIFT: 3 mm

Fruit length max3 mm

Fruit length min2 mm

Fruit width max1.5 mm

Fruit width min1 mm

Leaf length55 mm

Leaf length max140 mm

Leaf length min40 mm

Leaf size167 mm²

Leaf width7 mm

⚠ sources differ — AusTraits: 7 mm · GIFT: 10 mm

Leaf width max60 mm

Leaf width min10 mm

Plant height0.4 m

⚠ sources differ — GIFT: 0.4 m · AusTraits: 1 m · TRY: 0.19 m

Plant height max1 m

Plant height min0.1 m

Seed mass1.45 mg

⚠ sources differ — TRY: 1.45 mg · AusTraits: 1.49 mg · GIFT: 1.39 mg

Seed mass max1.7 mg

Seed mass min1.16 mg

Seed volume1.3 mm³

Seed volume max1.3 mm³

Seed volume min1.3 mm³

Life cycle & reproduction16

Deciduousnessevergreen

Dehiscenceindehiscent

Dispersal typeanimal

Flower colouryellow

Flowering endJul

Flowering startApr

Flowering timeyynnnnnnyyyy

Life formannual

Life spanannual

Lifespan years1 years

Pollination modebiotic

Pollination syndromeinsect

Raunkiær life formtherophyte

Resprouting capacityfire_killed

Self fertilizationabsent

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment15

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max2 000 m

Elevation mean1 600 m

Elevation min0 m

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typeachene

Growth formherb

Habitat GIFTCoastal

Leaf compoundnesssimple

Leaf formlinear

Leaf shapelanceolate

Woodinessnon-woody

Physiology & chemistry7

Leaf C:N ratio21.28 g/g

Leaf c406 mg/g

Leaf dry-matter content (LDMC)264 mg/g

Leaf n19.1 mg/g

Photosynthetic pathwayC3

Seed longevity index0

Specific leaf area (SLA)14.84 mm²/mg

Other traits3

Defenseyes

Seeds per fruit101-1000

Shoot orientationerect

03Chemical composition30 compounds

Compounds documented for Centaurea melitensis across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Germacrane sesquiterpenoids9

Dibenzylbutyrolactone lignans6

Flavones4

Ecdysteroids3

Flavonols2

Documented compounds30 total

Compound	Amount	Source
(-)-Arctigenin	present	LOTUS
(-)-Arctiin	present	LOTUS
(-)-Matairesinol	present	LOTUS
(3aR,4S,6E,10Z,11aR)-3a,4,5,8,9,11a-Hexahydro-4-hydroxy-10-(hydroxymethyl)-6-methyl-3-methylenecyclodeca(b)furan-2(3H)-one	present	LOTUS
(E)-3-[(2R,3R)-2-(3,4-dihydroxyphenyl)-3-(hydroxymethyl)-2,3-dihydro-1,4-benzodioxin-6-yl]prop-2-enal	present	LOTUS
1,11-Tridecadiene-3,5,7,9-tetrayne	present	LOTUS
2-Propenoic acid, 2-(hydroxymethyl)-, (3aR,4S,6E,10Z,11aR)-2,3,3a,4,5,8,9,11a-octahydro-10-(hydroxymethyl)-6-methyl-3-methylene-2-oxocyclodeca[b]furan-4-yl ester	present	LOTUS
20-Hydroxyecdysone	present	LOTUS
[(2S,3R,4S,5R,6R)-2-[4-[[(3R,4R)-4-[(3,4-dimethoxyphenyl)methyl]-2-oxooxolan-3-yl]methyl]-2-methoxyphenoxy]-3,5-dihydroxy-6-(hydroxymethyl)oxan-4-yl] (E)-3-(3,4-dihydroxyphenyl)prop-2-enoate	present	LOTUS
[(3aR,4S,6E,10Z,11aR)-10-(hydroxymethyl)-6-methyl-3-methylidene-2-oxo-3a,4,5,8,9,11a-hexahydrocyclodeca[b]furan-4-yl] (2S)-3-hydroxy-2-methylpropanoate	present	LOTUS

05DNA & barcoding45 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Centaurea melitensis has left across the world's sequence archives.

At a glance

DNA specimens45

Marker genes6

GenBank sequences10

eDNA detections17

Countries9

The DNA barcodea real sequence read deposited for this species

ITSMG219179.1 ↗341 bpUSA · 1985

ACGT

TGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATTCGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATC …

Centaurea melitensis voucher CCDB-24795-A04 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

matK3rbcL3rbcLaITS4ITS2trnH-psbA

plant barcodefungal barcodemarker

06Genome at a glanceCCDB · GIFT

The complete instruction manual Centaurea melitensis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size914 430 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Centaurea melitensis0.91 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 24 n = 12

Ploidydiploid inferred

Chromosome records14–402n range24median24mode56records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 2437×CCDB · ita-fl · CCDB · iber-fl · CCDB · fl-europaea +7

CCDB · ita-fl — COLOMBO P., MARCEN C., PRINCIOTTA R. - 1983. Numeros cromosomaticos de plantas occidentales, 239-250.. Anales Jard. Bot. Madrid , 40(1): 263-270.

CCDB · ita-fl — BARTOLO G., BRULLO S., GRILLO M., PAVONE P., ZIZZA A. - 1978. Numeri cromosomici per la flora italiana:382-397.. Inform. Bot. Ital. , 10(1): 64-80.

CCDB · iber-fl — Chromosome numbers in Iberian angiosperms. Bjorkqvist, I. & al.Bot. Not.122: 271-283(1969).

CCDB · iber-fl — Contribuiao para o conhecimento citotaxonmico das spermatophyta de Portugal. II. Compositae, supl. 1 Queirs, M.Bol. Soc. Brot. ser. 247: 299-314(1973).

CCDB · iber-fl — Contribution la connaissance cytotaxinomique des spermatophyta du Portugal. II. Compositae Fernandes, A. & M. Queirs.Bol. Soc. Brot. ser. 245: 5-121(1971).

CCDB · iber-fl — Estudios citogenticos en especies espaolas del gnero Centaurea. Granada. Fernndez Morales, M. J.*(1974).

CCDB · iber-fl — Notas cariolgicas sobre algunas compuestas de Andaluca. Arista, M., S. Talavera & P. L. Ortiz.Acta Bot. Malacitana20: 37-42(1995).

CCDB · iber-fl — Studies on the flora of the Balearic Islands, I. Dahlgren, R., Th. Karlsson & P. Lassen.Bot. Not.124: 249-269(1971).

CCDB · fl-europaea — Guinochet, 1957

CCDB · ipcn-api-dl — Natarajan, G. 1988. étude caryosystiématique de quelques dicotyledones de la Garrigue Languedocienne. Nat. Monspel. 52: 85–123.

CCDB · ipcn-api-dl — Hellwig, F. H. 1994. Chromosomenzahlen aus der Tribus Cardueae (Compositae). Willdenowia 24: 219–248.

CCDB · ipcn-api-dl — Hellwig, F., C. Oberprieler, R. Vogt & G. Wagenitz. 1994. Chromosome numbers of north African phanerograms. III. Some counts in Centaurea (Compositae, Cardueae). Willdenowia 24: 249–254.

CCDB · ipcn-api-dl — Bartolo, G., S. Brullo & P. PAVONE. 1978. Numeri cromosomici per la flora Italiana: 484-493. Inform. Bot. Ital. 10: 267–277.

CCDB · ipcn-api-dl — Natarajan, G. 1981. In Chromosome number reports LXXII. Taxon 30: 698–699.

CCDB · book-ipcn67-71 — BJ.ORKQVIST, I . , R. VON BOTHMER, O. NILSSON: & B. NORDENSTAM. 1969. Chromosome numbers in Iberian Angiosperms. Bot. Notiser 122: 271-28;

CCDB · book-ipcn67-71 — GUINOCHET, M. 1957. Contribution a l'etude caryologique du genre Centaurea L. sens. lat. soc. Hist. Nat. Afrique Nord 48: 282-300.

CCDB · book-ipcn67-71 — FERNANDES, A., & M. QUEIROS. 1971. Contribution a la connaissance cytotaxinomique des Spermatophyta du Portugal. II Compositae Bol. soc. Brot. 45 (ser. 2l: 5-122.

CCDB · book-ipcn73-74 — QUEIROS, M. 1973. Contribuicao para o conhecimento citotaxonomico dJ spermatophyta de Portugal. 47(Ser. 2l: 299-314. II Compositae, supl. I Bol. Soc. Brot. I

CCDB · book-ipcn73-74 — DAHLGREN, R., TH. KARLSSON, & P. LASSEN. 1971. Studies on the flora I < the Balearic Islands. I. Chromosome numbers in Balearic angiosperms. sot. Notiser 124: 249~269.

CCDB · book-ipcn73-74 — POWELL, A.M., D.W. KYHOS, & P.H. RAVEN. 1974. Chromosome numbers in Compositae. X. Amer. J. Bot. 61: 909-913.

CCDB · book-ipcn73-74 — VAN LOON, J. 1974. A cytological investigation of flowering plants from the Canary islands. Acta Bot. Neerl. 23: 113-124.

CCDB · book-indian_vol1 — Guinochet, M. 1957; Guinochet, M. & Foissac, J. 1962; Bjorkqvist, I. et al. 1969 ; Dahlgren, R. et al. 1971 ; Fern- andes, A. & Queiros, M. 1971; Morales, M. J. F. 1974 ; Powell, A. M. et al. 1974; Van Loon, J. C. 1974

CCDB · eflora

CCDB · CromoCat 2015 — Hellwig, F., Oberprieler, C., Vogt, & Wagenitz, G. (1994). Chromosome numbers of north African phanerograms. III. Some counts in Centaurea (Compositae, Cardueae). Willdenowia 24: 249–254.

CCDB · CromoCat 2015 — Bartolo, G., S. Brullo, M. Grillo, P. Pavone & A. Zizza. (1978b). Numeri cromosomatici per la Flora Italiana: 382-397. Inf. Bot. Ital. 10: 64-80.

CCDB · CromoCat 2015 — Björkqvist, I., von Bothmer, R., Nilsson, O. & Nordenstam, B. (1969). Chromosome numbers in Iberian angiosperms. Bot. Not. 122: 271-283.

CCDB · CromoCat 2015 — Colombo, P., Marcenó, C. & Princiotta, R. (1983b). Números cromosomáticos de plantas occidentales, 239-250. Anales Jard. Bot. Madrid 40: 263-270.

CCDB · CromoCat 2015 — Dahlgren, R., Karlsson, Th. & Lassen, P. (1971). Studies on the Flora of the Balearic Islands, I. Chromosome numbers in Balearic Angiosperms. Bot. Not. 124(1): 249-269.

CCDB · CromoCat 2015 — Fernandes, A. & Queirós, M. (1971a). Contribution à la connaissance cytotaxinomique des spermatophyta du Portugal. II. Compositae. Bol. Soc. Brot. 45: 5-122.

CCDB · CromoCat 2015 — Fernández Morales, M. J. (1974b). Estudios citogenéticos en especies españolas del género Centaurea. Granada

CCDB · CromoCat 2015 — Govindaraj, N. (1988). Étude caryosystematique de quelques Dicotyledones de la garrigue languedocienne. Nat. Monsp. Bot. 52: 85-123.

CCDB · CromoCat 2015 — Guinochet, M. (1957). Contribution à l'étude caryologique du genre Centaurea L. s.l. Bull. Soc. Hist. Nat. Afrique N. 48: 282-300.

CCDB · CromoCat 2015 — Hellwig, F. H. (1994). Chromosomenzahlen aus der Tribus Cardueae (Compositae). Willdenowia 24: 219-248.

CCDB · CromoCat 2015 — Loon van, J. C. (1974). A cytological investigation of flowering plants from the Canary islands. Acta Bot. Neerl. 23: 113-124.

CCDB · CromoCat 2015 — Natarajan, G. (1981). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXXII]. Taxon 30(3): 698-699.

CCDB · CromoCat 2015 — Queirós, M. (1973b). Contribuiçao para o conhecimento citotaxonómico das Spermatophyta de Portugal. II. Compositae, supl. 1. Bol. Soc. Brot. 47: 299-314.

GIFT · GIFT (floras)

2n 205×CCDB · iber-fl · CCDB · ipcn-api-dl · CCDB · book-ipcn75-78 +1

CCDB · iber-fl — Chromosomenzahlen aus der Tribus Cardueae (Compositae). Hellwig, H. Frank.Willdenowia24: 219-248(1994).

CCDB · ipcn-api-dl — Brullo, S., A. Guglielmo, P. Pavone & M. C. Terrasi. 1990. Chromosome counts of flowering plants from N. Cyrenaica. Candollea 45: 65–74.

CCDB · ipcn-api-dl — Mohamed, M. K. 1997. Chromosome counts in some flowering plants from Egypt. Egypt. J. Bot. 37(2): 129–156.

CCDB · book-ipcn75-78 — Brullo & Pavone 1977

CCDB · book-indian_vol1 — Mangenot, S. & Mangenot, G. 1962; Peng, C.-I. & Hsu, C.-C. 1977, 1978

2n 365×CCDB · ita-fl · CCDB · book-indian_vol1 · CCDB · Cave1956supp +2

CCDB · ita-fl — CHIAPPINI M. - 1954. Ricerche sullo sviluppo embriologico di alcune specie del genere Centaurea L. (Asteraceae).. N. Giorn. Bot. Ital. , 61: 274-289.

CCDB · book-indian_vol1 — Chiappini, M. 1954

CCDB · Cave1956supp — Chiappini 1955

CCDB · CromoCat 2015 — Chiappini, M. (1954). Ricerche sullo sviluppo embriologico di alcune specie del genere Centaurea L. (Asteraceae). Nuovo Giorn. Bot. Ital. 61: 274-289.

GIFT · GIFT (floras)

2n 223×CCDB · book-indian_vol1 · CCDB · book-atlas-flowering-plants · GIFT · GIFT (floras)

CCDB · book-indian_vol1 — Covas, G. & Schnack, B. 1947

CCDB · book-atlas-flowering-plants — Covas & S. 1947

GIFT · GIFT (floras)

2n 263×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 · CCDB · eflora

CCDB · ipcn-api-dl — Hellwig, F. H. 1994. Chromosomenzahlen aus der Tribus Cardueae (Compositae). Willdenowia 24: 219–248.

CCDB · book-ipcn67-71 — SMITH, E.B. 1969. In IOPB chromosome number reports XXII. Taxon 18: 433-442.

CCDB · eflora

2n 402×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Kamel, E. A. R. 2001. Chromosome counts and karyological studies on six taxa of Egyptian Asteraceae. Compositae Newslett. 36: 81–94.

CCDB · ipcn-api-dl — Kamel. 2004. Cytotaxonomical investigations of the Egyptian Compositae (Asteraceae): I---Cardueae and Cichorieae. Compositae Newslett. 41: 9–28.

2n 01×CCDB · CromoCat 2015

CCDB · CromoCat 2015 — Ward, D.E. & R.W. Spellenberg. (1986). Chromosome counts of angiosperms of western North America Phytologia 61: 119-125

2n 141×CCDB · book-indian_vol1

CCDB · book-indian_vol1 — Malla, S. B., Bhattarai, S. et al. 1978a

n 129×CCDB · iber-fl · CCDB · ipcn-api-dl · CCDB · book-ipcn73-74 +1

CCDB · iber-fl — Estudios citogenticos en especies espaolas del gnero Centaurea. Granada. Fernndez Morales, M. J.*(1974).

CCDB · iber-fl — IOPB. Chromosome number reports. XLVI. Fernndez Morales, M. J.Taxon23(5/6): 805(1974).

CCDB · ipcn-api-dl — Ward, D. E. & R. W. Spellenberg. 1986. Chromosome counts of angiosperms of western North America. Phytologia 61: 119–125.

CCDB · book-ipcn73-74 — FERNANDEZ MORALES, M.J. 1974. In IOPB chromosome number reports XLVJ Taxon 23: 801-812. I

CCDB · book-ipcn73-74 — POWELL, A.M., D.W. KYHOS, & P.H. RAVEN. 1974. Chromosome numbers in Compositae. X. Amer. J. Bot. 61: 909-913.

CCDB · CromoCat 2015 — Fernández Morales, M. J. (1974a). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports XLVI]. Taxon 23(5/6): 805.

CCDB · CromoCat 2015 — Fernández Morales, M. J. (1974b). Estudios citogenéticos en especies españolas del género Centaurea. Granada

CCDB · CromoCat 2015 — Powell, A. M., D. W. Kyhos & P. H. Raven. (1974). Chromosome numbers in Compositae. X. Amer. J. Bot. 61: 909-913.

CCDB · CromoCat 2015 — Ward, D.E. & R.W. Spellenberg. (1986). Chromosome counts of angiosperms of western North America Phytologia 61: 119-125

n 01×CCDB · CromoCat 2015

CCDB · CromoCat 2015 — Hellwig, F., Oberprieler, C., Vogt, & Wagenitz, G. (1994). Chromosome numbers of north African phanerograms. III. Some counts in Centaurea (Compositae, Cardueae). Willdenowia 24: 249–254.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

07Deep time~1.4 Ma lineage

How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.

At a glance

DNA clock origin1.4 Ma TimeTree

When this lineage existed

How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.

DNA clock origin

How it livedPBDB

Dietphotoautotroph

08Occurrence & distribution

Record type28 035 records

Wild obs. + sensor22 623

Museum / vouchered4 910

Cultivated / captive2

Other500

Origin

Native2 884

Introduced6 104

Range

Area of Occupancy AOO55 692 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy82% within 1 km

≤100 m 10 707≤1 km 4 688≤10 km 3 140>10 km 289

18 824 georeferenced · 3 799 without coordinates

Open the mapobservation + sensor22 623

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy57% within 1 km

≤100 m 582≤1 km 983≤10 km 988>10 km 177

2 730 georeferenced · 2 180 without coordinates

Open the institutions mapphysical evidence4 910

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions131 of 206 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Adelaide, AU	386
San Diego, US	308
UChlocation not on record	254
Claremont, US	191
Mount Annan, AU	148
Canberra, AU	135
Museo Entomologico de Leonlocation not on record	135
Kensington, AU	132
Riverside, US	127
València, ES	120
Santa Barbara, US	117
Brisbane, AU	114
Austin, US	107
San Luis Obispo, US	80
ASUlocation not on record	76
BIO-UNIPIlocation not on record	74
Canadian Department of Agriculturelocation not on record	69
Jaén, ES	62
MAlocation not on record	60
Davis, US	54
Córdoba, AR	54
BClocation not on record	51
College of the Atlantic, Museumlocation not on record	50
BDBClocation not on record	48
Vitoria, ES	47
Córdoba, ES	47
Bronx, US	44
CICYTEXlocation not on record	43
US	42
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	41
San Isidro, AR	40
NSW Dept of Planning, Industry and Environmentlocation not on record	36
Pretoria, ZA	35
Barcelona, ES	34
Madrid, ES	33
Fort Worth, US	32
ISAlocation not on record	32
Phoenix, US	30
LDlocation not on record	30
EL PASO, US	30
MeiseBGlocation not on record	30
Granada, ES	28
Flagstaff, US	28
South Kensington, GB	27
Entomological Society of Latvialocation not on record	27
Irvine, US	25
Badajoz, ES	25
Hobart, AU	25
Severin-McDaniel Insect Collectionlocation not on record	25
Corvallis, US	24
Alicante, ES	22
Salamanca, ES	22
CJBGlocation not on record	21
Angwin, US	19
University of Stellenboschlocation not on record	18
Los Angeles, US	18
San Sebastián, ES	18
EEZA-CSIClocation not on record	18
Albuquerque, US	17
Armidale, AU	16
CASlocation not on record	16
Ensenada, MX	15
Long Beach, US	15
Wuzhou, CN	15
Porto Alegre, BR	14
Pullman, US	14
Sevilla, ES	13
Universidad del Pais Vasco (UPV/EHU)location not on record	13
Christchurch, NZ	13
Kew, GB	12
UIBlocation not on record	12
San Bernardino, US	12
Arcata, US	12
WTUlocation not on record	11
Phyletisches Museum Jenalocation not on record	11
BISHlocation not on record	11
Palmerston, AU	10
Museo della Bonifica di San Donà di Piavelocation not on record	10
Pamplona, ES	10
Texas Lutheran Universitylocation not on record	10
Trondheim, NO	10
Saint Louis, US	10
Auckland, NZ	9
NSW Office of Environment and Heritagelocation not on record	9
Philadelphia, US	9
Pamplona, ES	9
Wellington, NZ	8
Institut und Museum fuer Geologie und Palaeontologielocation not on record	8
John T. Waterhouse Herbariumlocation not on record	8
Laboratory of Palaeontologylocation not on record	7
Catalina Island Conservancylocation not on record	7
Castelar, AR	7
Valparaiso, CL	7
Corrientes, AR	7
Oskarshamn, SE	7
Wlocation not on record	7
Paris, FR	7
Mexico City, MX	6
Stockholm, SE	6
Museo Achille Folettolocation not on record	6
Bern, CH	6
Berlin, DE	6
Moscow, US	5
Santa Cruz, US	5
BSBIlocation not on record	5
San Francisco, US	5
Mexico City, MX	5
Görlitz, DE	5
Durban, ZA	4
Bloomington, US	4
Northridge, US	4
Parkville, AU	4
La Paz, MX	4
Bangkok, TH	4
Logan, US	4
Brussel, BE	4
Hermosillo, MX	4
JBSlocation not on record	4
Lubbock, US	4
Universidade Federale do Rio Grande do Sullocation not on record	3
Joondalup, AU	3
Provo, US	3
Herbario Universidad de Concepciónlocation not on record	3
Vancouver, CA	3
Valparaíso, CL	3
Arizona State University Biocollectionslocation not on record	3
Olocation not on record	3
Denton, US	2
Uppsala, SE	2
BRNUlocation not on record	2
Smithfield, AU	2
GJOlocation not on record	2
Canadian Museum of Nature, National Herbarium of Canadalocation not on record	2
WAGlocation not on record	2
Victoria, CA	2
Chicago, US	2
Odawara, JP	2
National Museums of Kenyalocation not on record	2
Denver, US	2
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	2
San Jose, US	2
Coimbra, PT	2
DOI/NPS, Greenbelt Parklocation not on record	2
J, Alocation not on record	2
Turku, FI	2
Natural History Museum Rotterdamlocation not on record	2
USFSlocation not on record	2
Monastir, TN	2
La Paz, BO	2
Durango, MX	2
Chongqing Museumlocation not on record	2
Henry Brockhouse Collectionlocation not on record	2
San Angelo, US	2
Henderson, US	1
Cape Town, ZA	1
Honolulu, US	1
Guangzhou, CN	1
Kagoshima, JP	1
Chadron, US	1
Pittsburg, US	1
AUAlocation not on record	1
Tuscaloosa, US	1
Calabar, NG	1
Fredericton Stock Culture Collectionlocation not on record	1
Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record	1
Frankfurt am Main	1
Mlocation not on record	1
Montecillo, Texcoco, MX	1
Provincia di Livornolocation not on record	1
Columbia, US	1
BAYLUlocation not on record	1
Clocation not on record	1
STNFlocation not on record	1
Cambridge, US	1
Toyama, JP	1
Moscow State Universitylocation not on record	1
San Diego Natural History Museum, Herbariumlocation not on record	1
Smithsonian Institution, National Museum of Natural Historylocation not on record	1
Chapel Hill, US	1
Podgorica, ME	1
Dekalb, US	1
Bureau of Land Management, Medford District Officelocation not on record	1
BAlocation not on record	1
Fullerton, US	1
Jackson, US	1
Masindi, UG	1
University of Alberta Museumslocation not on record	1
Macomb, US	1
Torreón, MX	1
Austin, US	1
Boise, US	1
BFLlocation not on record	1
Clemson, US	1
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1
Baltimore, US	1
Weber State Universitylocation not on record	1
Juriquilla, MX	1
Haramaya Universitylocation not on record	1
Jena Microbial Resource Collectionlocation not on record	1
Dresden, DE	1
MMHNSRlocation not on record	1
Uniwersytet Śląski w Katowicachlocation not on record	1
Mississippi State, US	1
Bergen, NO	1
DOI/NPS, Colonial National Historical Parklocation not on record	1
Viña del Mar, CL	1

206 institutions · 4 619 of 4 910 vouchered records shown · 289 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA17 detections

Where the DNA of Centaurea melitensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found17

Studies independent surveys1

Countries5

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 17 detections have coordinates

Open the map5 countries0

on a steep, rocky bank with Sonchus, Mentzel…Navarretia hamata

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.4 °C 7.40–24.9

Seasonal swing summer↔winter15.7 °C

Max temp (day)20.5 °C 10.3–30.5

Min temp (night)10.4 °C 5.20–20.1

Precipitation70.4 mm/mo 43.8–113

Air humidity59.8 % 55.6–66.6

Moisture balance-28.0 mm/mo -108–36.2

Vapour deficit804 Pa 353–1,404

Wind speed2.90 m/s 2.10–4.40

Cloud cover41.2 % 26.5–49.6

CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

At a glance

Sources15 archives

Size & morphology21

Life cycle & reproduction16

Diet & foraging1

Habitat & environment15

Physiology & chemistry7

Other traits3

Compound class profile5 classes

Documented compounds30 total

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

At a glance

When this lineage existed

How it livedPBDB

Record type28 035 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions131 of 206 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type28 035 records