Centaurea jacea
speciesAt a glance
Occurrence records475 079
Data sources15
Biological traits50
DNA specimens56
eDNA detections31
Sources15 archives
Databases and archives Centaurea jacea's data was compiled from.
WikipediaWikimedia Foundation12 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility475 079 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI31 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics56 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources50 traits
Chemical compositionLOTUS · NPASS42 compounds
Occurrence & distributionGBIF475 079 records
Environmental DNA1 datasets · 8 countries31 detections
DNA & barcodingBOLD · NCBI56 specimens
Genome at a glanceCCDB · GoaT1.9 Gbp
01Narrative
Centaurea jacea, brown knapweed or brownray knapweed, is a species of herbaceous perennial plants in the genus Centaurea native to dry meadows and open woodland throughout Europe. It grows to 10 – tall, and flowers mainly from June to September. Centaurea jacea In Britain and America, it is often found as a hybrid of black knapweed, Centaurea nigra. Unlike the black knapweed, the flower heads always look as if they are rayed, forming a more open star rather than a brush-like tuft.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTAusTraitsLEDATRYWCVP
Size & morphology12
Fruit length3 mm
Leaf length200 mm
Leaf size1 809 mm²
Leaf width25 mm
Plant height0.85 m
⚠ sources differ — GIFT: 0.85 m · AusTraits: 1.1 m · LEDA: 0.85 m · TRY: 0.269 m
Plant height generative0.394 m
Plant height max1.5 m
Plant height min0.1 m
Seed length2.94 mm
Seed mass1.47 mg
⚠ sources differ — TRY: 1.47 mg · LEDA: 2 mg · GIFT: 1.6 mg
Seed mass max1.72 mg
Seed mass min1.06 mg
Life cycle & reproduction14
Deciduousnessaestival
⚠ sources differ — TRY: aestival · GIFT: deciduous
Dehiscenceindehiscent
Dispersal typeanimal
Flowering endAug
Flowering startJun
Life formperennial
Life spanperennial
⚠ sources differ — TRY: perennial · AusTraits: annual biennial · LEDA: perennials · GIFT: perennial
Lifespan years3 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formhemicryptophyte
Reproduction asexualabsent
Seed number235
Self fertilizationpresent
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment13
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max500 m
Elevation min0 m
Epiphyteterrestrial
Fruit typeachene
Growth formherb
Habitat GIFTcut-over forest, forest edges, meadows, shrubberies
Leaf compoundnesssimple
Leaf shapelanceolate linear
Mycorrhiza typearbuscular
Woodinessnon-woody
Physiology & chemistry8
Leaf C:N ratio18.82 g/g
Leaf c439 mg/g
Leaf dry-matter content (LDMC)211 mg/g
Leaf n23.95 mg/g
Photosynthetic pathwayC3
Seed longevity index0
Specific leaf area (SLA)19.94 mm²/mg
⚠ sources differ — TRY: 19.94 mm²/mg · LEDA: 16.3 mm²/mg · GIFT: 16.41 mm²/mg
Wood density58.01 mg/cm³
Other traits1
Diaspore typegenerative dispersule
03Chemical composition42 compounds
Compounds documented for Centaurea jacea across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Flavonols8
Fatty aldehydes7
Flavones6
Fatty alcohols $ Fatty aldehydes3
Bisabolane sesquiterpenoids2
Documented compounds42 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (1R,3R,4S,5R)-Methyl 3-(3-(3,4-Dihydroxyphenyl)Acryloyloxy)-1,4,5-Trihydroxycyclohexanecarboxylate | present | LOTUS | |
| (2R)-2-[(1E,9E)-undeca-1,9-dien-3,5,7-triynyl]oxirane | present | NPASS | |
| (2R,3R,4S,5R,6S)-2-methyl-6-[(2S)-6-methyl-2-[(1S)-4-methylcyclohex-3-en-1-yl]hept-5-en-2-yl]oxyoxane-3,4,5-triol | present | NPASS | |
| (2S,3E,11E)-trideca-3,11-dien-5,7,9-triyne-1,2-diol | present | NPASS | |
| (2S,3R,4S,5R,6R)-2-[[(1S,4aS,7R,8aS)-1,4a-dimethyl-7-prop-1-en-2-yl-2,3,4,5,6,7,8,8a-octahydronaphthalen-1-yl]oxy]-6-methyloxane-3,4,5-triol | present | NPASS | |
| (5E,7E,13E)-pentadeca-5,7,13-trien-9,11-diynal | present | LOTUS | |
| (6E,8E,14E)-hexadeca-6,8,14-trien-10,12-diynal | present | LOTUS | |
| (7E,9E,11E,13E)-hexadeca-7,9,11,13-tetraenal | present | LOTUS | |
| (7E,9E,15E)-heptadeca-7,9,15-trien-11,13-diynal | present | LOTUS | |
| 1,11-Tridecadiene-3,5,7,9-tetrayne | present | LOTUS |
05DNA & barcoding56 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Centaurea jacea has left across the world's sequence archives.
At a glance
DNA specimens56
Marker genes9
GenBank sequences10
eDNA detections31
Countries11
The DNA barcodea real sequence read deposited for this species
GTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATTCGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCA …
Centaurea jacea subsp. timbalii voucher PLT.0659 5.8S ribosomal RNA gene and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK★rbcL6★rbcLa★trnL-F★ITS4★ITS2atpF-atpHrpoC1trnH-psbA
plant barcodefungal barcodemarker
06Genome at a glanceCCDB · GoaT
The complete instruction manual Centaurea jacea carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size1 858 200 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Centaurea jacea1.86 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 44 n = 22
Ploidy4× tetraploid · measured
Chromosome records18–442n range44median44mode92records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 4450×GoaT · Kew Plant DNA C-values Database · CCDB · slov-fl · CCDB · iber-fl +11
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · slov-fl — Májovský J. et al., 1970b: Index of chromosome numbers of Slovakian flora Part 2. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 18: 45-60.
CCDB · slov-fl — Májovský J. et al., 1974a: Index of chromosome numbers of Slovakian flora (Part 3). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 22: 1-20.
CCDB · slov-fl — Májovský J. et al., 1974b: Index of chromosome numbers of Slovakian flora Part 4. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 23: 1-23.
CCDB · iber-fl — Contribution la connaissance cytotaxinomique des spermatophyta du Portugal. II. Compositae Fernandes, A. & M. Queirs.Bol. Soc. Brot. ser. 245: 5-121(1971).
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=3878
CCDB · fl-europaea — Gardou, 1972
CCDB · fl-europaea — Tamavschi, 1948
CCDB · poland — Skali?ska M., Jankun A., Wcis?o H. et al. 1976. Further studies in chromosome numbers of Polish Angiosperms. Eleventh contribution. Acta Biol. Cracov. Ser. Bot. 19, 107-148.
CCDB · ipcn-api-dl — Lovric, A. Z. 1982. In IOPB chromosome number reports LXXVII. Taxon 31: 762–763.
CCDB · ipcn-api-dl — Lovric, A. Z. 1982a. In IOPB chromosome number reports LXXVII. Taxon 31: 774–775.
CCDB · ipcn-api-dl — Kuzmanov, B. A., S. B. Georgieva & V. A. Nikolova. 1986. Chromosome numbers of Bulgarian flowering plants. I. Fam. Asteraceae. Fitologija 31: 71–74.
CCDB · ipcn-api-dl — Dmitrieva, S. A. & V. I. Parfenov. 1985. Kariologicheskaja kharakteristika nekotorykh vidov poleznykh rastenij flory Belorussii. Izv. Akad. Nauk Belorussk. SSR, Ser. Biol. Nauk 6: 3–8.
CCDB · ipcn-api-dl — Arohonka, T. 1982. Chromosome counts of vascular plants of the island Seili in Nauvo, southwestern Finland. Turun Yliopiston Julkaisuja, Sar. A 2, Biol.-Geogr. 3: 1–12.
CCDB · ipcn-api-dl — Buttler, K. P. 1985. Chromosomenzahlen von Gefässpflanzen aus Hessen (und angrenzenden Ländern), 3. Folge. Hess. Florist. Briefe 34: 37–42.
CCDB · ipcn-api-dl — Lippert, W. & G. R. Heubl. 1988. Chromosomenzahlen von Pflanzen aus Bayern und angrenzenden Gebieten: [Teil 1]. Ber. Bayer. Bot. Ges. 59: 13–22.
CCDB · ipcn-api-dl — Dmitrieva, S. A. 1986. Chisla khromosom nekotorych vidov rastenij Berezinskogo Biosfernogo Zapovednika. Zapov. Belorussii Issl. 10: 24–28.
CCDB · ipcn-api-dl — Druskovic, B. & M. Lovka. 1995. IOPB chromosome data 9. Int. Organ. Pl. Biosyst. Newslett. (Zurich) 24: 15–19.
CCDB · ipcn-api-dl — Probatova, N. S., E. G. Rudyka & A. P. Sokolovskaya. 1996. Chromosome numbers in synanthropic plants from the Russian Far East. Bot. Žhurn. (Moscow & Leningrad) 81(5): 98–101.
CCDB · ipcn-api-dl — Parra, R., B. Valdés, A. Álvarez, J. Villarreal & J. Roldán. 1998. Números cromosómicos para la flora española. 793--805. Lagascalia 20(2): 302–308.
CCDB · ipcn-api-dl — Albers, F. & W. Pröbsting. 1998. In R. Wisskirchen & H. Haeupler, Standardliste der Farn- und Blütenpflanzen Deutschlands. Bundesamt für Naturschutz & Verlag Eugen Ulmer, Stuttgart.
CCDB · ipcn-api-dl — Kiehn, M., E. Vitek & C. Dobea. 2000. In C. Dobea & E. Vitek, Documented Chromosome Number Checklist of Austrian Vascular Plants. Verlag des Naturhistorischen Museums Wien, Vienna.
CCDB · ipcn-api-dl — Lövkvist, B. & U. M. Hultgård. 1999. Chromosome numbers in south Swedish vascular plants. Opera Bot. 137: 1–42.
CCDB · ipcn-api-dl — Morton, J. K. 1981. Chromosome numbers in Compositae from Canada and the U.S.A. Bot. J. Linn. Soc. 82: 357–368.
CCDB · ipcn-api-dl — Skalinska, M., H. JANKUN, H. Wcislo & e. al. 1976. Further studies in chromosome numbers of Polish angiosperms. XI. Acta Biol. Cracov., Ser. Bot. 19: 107–148.
CCDB · ipcn-api-dl — Dmitrieva, S. A., V. I. Parfenov & I. V. SCHVEC. 1977. The karyological characterization of some species of the Belorussian flora. Vesci Akad. Navuk Belarusk SSR Ser. Bi jal. Sel'skagasp. Navuk. 19: 82–91.
CCDB · ipcn-api-dl — Bancheva, S. & J. Greilhuber. 2006. Genome size in Bulgarian Centaurea s.l. (Asteraceae). Pl. Syst. Evol. 257: 95–117.
CCDB · ipcn-api-dl — Vanderhoeven, S., O. Hardy, X. Vekemans, C. Lefèbvre, M. d. Loose, J. Lambinon & P. Meerts. 2002. A morphometric study of populations of the Centaurea jacea complex (Asteraceae) in Belgium. Pl. Biol. (Stuttgart) 4: 403–412.
CCDB · book-ipcn72 — GARDOU, c. 1972. Recherches biosystematiques sur la Section Jacea Cass. et quelques sections voisines du genre Centaurea L. en France et dans les regions limitrophes. Feddes Repert. 83: 311-472.
CCDB · book-ipcn67-71 — FERNANDES, A., & M. QUEIROS. 1971. Contribution a la connaissance cytotaxinomique des Spermatophyta du Portugal. II Compositae Bol. soc. Brot. 45 (ser. 2l: 5-122.
CCDB · book-ipcn67-71 — TONJAN, Z.R. 1968. The chromosome numbers of some species of the genus Centaurea. (In Russian) Biol. Zurn. Arm. S.S.R. 21: 86-96.
CCDB · book-ipcn67-71 — GUINOCHET, M. 1957. Contribution a l'etude caryologique du genre Centaurea L. sens. lat. soc. Hist. Nat. Afrique Nord 48: 282-300.
CCDB · book-ipcn75-78 — Kuzmanov & Georgieva 1977
CCDB · book-atlas-flowering-plants — Roy 1937, Wulff '37b
CCDB · kew — Bancheva S, Greilhuber J. 2006. Genome size in Bulgarian Centaurea s.l. (Asteraceae). Plant Systematics and Evolution 257: 95-117.
CCDB · CromoCat 2015 — Bancheva, S. & Greilhuber, J. (2006). Genome size in Bulgarian Centaurea s.l. (Asteraceae). Plant Systematics and Evolution 257:95-117.
CCDB · CromoCat 2015 — Kiehn, M., Vitek, E. & Dobeš, C. (2000). In C. Dobeš & E. Vitek, Documented Chromosome Number Checklist of Austrian Vascular Plants. Verlag des Naturhistorischen Museums Wien, Vienn
CCDB · CromoCat 2015 — Lippert. (2006). Chromosomenzahlen von Pflanzen aus Bayern und anderen Gebieten. Ber. Bayer. Bot. Ges. 76: 85–110.
CCDB · CromoCat 2015 — Druskovic, B. & Lovka, M. (1995). IOPB Chromosome Data 9 (ed. C.A. Stace). Int. Organ. Pl. Biosyst. Newslett. 24: 15-19.
CCDB · CromoCat 2015 — Lippert, W. & Heubl, G.R. (1988). Chromosomenzahlen von Pflanzen aus Bayern und angrenzeden Gebieten (Teil 1) Ber. Bayer. Bot. Ges. 59: 13-22.
+4 more references
2n 2236×GoaT · Kew Plant DNA C-values Database · CCDB · ita-fl · CCDB · iapt +8
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · ita-fl — GARDOU C. - 1972. Recherches biosystmatiques sur la section Jacea Cass. et quelques sections voisines du genre Centaurea L. en France et dans les rgions limitrophes.. Feddes Repert. , 83(5-6): 311-472.
CCDB · ita-fl — GARDOU C. - 1962. Nouvelles observations sur les types diploides de Centaurea jacea L. ssp. angustifolia Gremli.. Rev. Cytol. Biol. Vg. Botaniste , 25(3-4): 367-372.
CCDB · iapt — IAPT/IOPB Chromosome Data 6
CCDB · iber-fl — IOPB. Chromosome number reports. XXXVII. Gardou, C.Taxon21(4): 497(1972).
CCDB · fl-europaea — Gardou, 1972
CCDB · fl-europaea — Guinochet, 1957
CCDB · ipcn-api-dl — Lippert, W. & G. R. Heubl. 1988. Chromosomenzahlen von Pflanzen aus Bayern und angrenzenden Gebieten: [Teil 1]. Ber. Bayer. Bot. Ges. 59: 13–22.
CCDB · ipcn-api-dl — Lovric, A. Z. 1982. In IOPB chromosome number reports LXXVII. Taxon 31: 762–763.
CCDB · ipcn-api-dl — Kuzmanov, B. A., S. B. Georgieva & V. A. Nikolova. 1986. Chromosome numbers of Bulgarian flowering plants. I. Fam. Asteraceae. Fitologija 31: 71–74.
CCDB · ipcn-api-dl — Kuzmanov, B., D. Ninova & S. Georgieva. 1979. In IOPB chromosome number reports LXIV. Taxon 28:408.
CCDB · book-ipcn72 — GARDOU, c. 1972. In IOPB chromosome number reports XXXVII. Taxon 21: 495-500.
CCDB · book-ipcn67-71 — MOORE, R.J. 1968. In IOPB chromosome number reports XVIII. Taxon 17: 419-422.
CCDB · book-ipcn67-71 — GARDOU, c. 1971. Essais biosystematique des Centaurea jacea L. diploides des Alpes du Sud. Actes du Colloque sur la Flore et la Vegetation des Chaines Alpine et Jurassienne. Paris. pp. 293-308.
CCDB · book-ipcn67-71 — FERNANDES, A., & M. QUEIROS. 1971. Contribution a la connaissance cytotaxinomique des Spermatophyta du Portugal. II Compositae Bol. soc. Brot. 45 (ser. 2l: 5-122.
CCDB · kew — Koutecký P. A diploid drop in the tetraploid ocean: hybridization and longterm survival of a singular population of Centaurea weldeniana Rchb. (Asteraceae), a taxon new to Austria. Plant Systematics and Evolution 298: 1349-1360.
CCDB · Cave1956 — Guinooht a
CCDB · CromoCat 2015 — Gardou, C. (1972b). Recherches biosystématiques sur la Section Jacea Cass. et quelques Sections voisines du genre Centaurea L. en France et dans les régions limitrophes. Feddes Repert. 83: 311-472.
CCDB · CromoCat 2015 — Kuzmanov, B. & Georgieva, S. (1990). Cytotaxonomy of Bulgarian Centaurea species. In: Razprave IV razr. SAZU 31(7): 105-125.
CCDB · CromoCat 2015 — Kuzmanov, B., Georgieva, S. & Nikolova, V. (1986). Chromosome numbers of Bulgarian flowering plants. I, Fam. Asteraceae. Fitologija 31: 71-74.
CCDB · CromoCat 2015 — Moore, R. J. (1968). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports XVIII]. Taxon 17(4): 421.
CCDB · CromoCat 2015 — Probatova, N. S., Rudyka, E. G., Seledets, V. P. & Nechaev, V. A. (2008). IAPT/IOPB Chromosome Data 6 Taxon 57(4): 1267-1273
CCDB · CromoCat 2015 — Kuzmanov, B., Ninova, D. & Georgieva, S. (1979a). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXIV]. Taxon 28(4): 408.
2n 182×CCDB · ita-fl · CCDB · kew
CCDB · ita-fl — BINI MALECI L. - 1975. Numeri cromosomici per la flora Italiana:196-198.. Inform. Bot. Ital. , 7(3): 365-367.
CCDB · kew — Siljak-Yakovlev S, Pustahija F, Šolic EM, Bogunic F, Muratovic E, Bašic N, Catrice O, Brown SC. 2010. Towards a genome size and chromosome number database of Balkan flora: C-values in 343 taxa with novel values for 242. Advanced Science Letters 3: 190-213
2n 202×CCDB · iapt · CCDB · CromoCat 2015
CCDB · iapt — IAPT/IOPB Chromosome Data 5
CCDB · CromoCat 2015 — Probatova, N. S. & Seledets, V. P. (2008). IAPT/IOPB Chromosome Data 5 Taxon 57(2): 553-562
2n 362×GoaT · Kew Plant DNA C-values Database · CCDB · kew
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · kew — Bancheva S, Greilhuber J. 2006. Genome size in Bulgarian Centaurea s.l. (Asteraceae). Plant Systematics and Evolution 257: 95-117.
n 114×CCDB · ita-fl
CCDB · ita-fl — GARDOU C. - 1962. Nouvelles observations sur les types diploides de Centaurea jacea L. ssp. angustifolia Gremli.. Rev. Cytol. Biol. Vg. Botaniste , 25(3-4): 367-372.
n 03×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Bancheva, S. & Greilhuber, J. (2006). Genome size in Bulgarian Centaurea s.l. (Asteraceae). Plant Systematics and Evolution 257:95-117.
CCDB · CromoCat 2015 — Kiehn, M., Vitek, E. & Dobeš, C. (2000). In C. Dobeš & E. Vitek, Documented Chromosome Number Checklist of Austrian Vascular Plants. Verlag des Naturhistorischen Museums Wien, Vienn
CCDB · CromoCat 2015 — Lippert. (2006). Chromosomenzahlen von Pflanzen aus Bayern und anderen Gebieten. Ber. Bayer. Bot. Ges. 76: 85–110.
n 222×CCDB · Cave1963 · CCDB · CromoCat 2015
CCDB · Cave1963 — Sorsa 1962
CCDB · CromoCat 2015 — Sorsa, V. (1962). Chromosomenzahlen Finnischer Kormophyten, I. Ann. Acad. Sci. Fenn., Sér. A 58: 1-14.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
tetraploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
07Deep time~1.29 Ma lineage
How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.
At a glance
DNA clock origin1.29 Ma TimeTree
When this lineage existed
How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.
DNA clock origin
How it livedPBDB
Dietphotoautotroph
08Occurrence & distribution
Record type475 079 records
Wild obs. + sensor451 966
Museum / vouchered20 053
Cultivated / captive243
Other2 817
Origin
Native83
Introduced70
Range
Area of Occupancy AOO373 620 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy40% within 1 km
≤100 m 71 781≤1 km 63 653≤10 km 197 908>10 km 1 698
335 040 georeferenced · 116 926 without coordinates
Open the mapobservation + sensor451 966
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy43% within 1 km
≤100 m 1 913≤1 km 4 793≤10 km 8 572>10 km 246
15 524 georeferenced · 4 529 without coordinates
Open the institutions mapphysical evidence20 053
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
≤10 km 4>10 km 30
34 georeferenced · 209 without coordinates
Open the mapnot free-living243
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions129 of 232 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 10 007 |
| Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record | 1 215 |
| BFLlocation not on record | 587 |
| LDlocation not on record | 519 |
| Moscow State Universitylocation not on record | 428 |
| Olocation not on record | 331 |
| BRNUlocation not on record | 329 |
| IFR-DNFlocation not on record | 236 |
| MeiseBGlocation not on record | 232 |
| Salzburg, AT | 226 |
| Adam Mickiewicz University in Poznańlocation not on record | 225 |
| Oulu, FI | 186 |
| SLU Artdatabankenlocation not on record | 175 |
| Trondheim, NO | 171 |
| Oskarshamn, SE | 165 |
| KMNlocation not on record | 156 |
| Turku, FI | 152 |
| Kuopio, FI | 149 |
| Görlitz, DE | 138 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 103 |
| Uniwersytet Warszawskilocation not on record | 102 |
| BDBClocation not on record | 90 |
| Bergen, NO | 86 |
| Tartu, EE | 76 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 74 |
| Tallinn, EE | 73 |
| Jyväskylä, FI | 68 |
| Vitoria, ES | 68 |
| Karlsruhe, DE | 67 |
| Mlocation not on record | 64 |
| Berlin, DE | 62 |
| Chongqing Museumlocation not on record | 57 |
| South Kensington, GB | 57 |
| BIO-UNIPIlocation not on record | 53 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 51 |
| Barcelona, ES | 51 |
| Québec, CA | 50 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 49 |
| Philadelphia, US | 49 |
| Provincia di Livornolocation not on record | 44 |
| Uppsala, SE | 41 |
| Helsinki, FI | 37 |
| Wlocation not on record | 33 |
| TROMlocation not on record | 33 |
| DBF-NHMDlocation not on record | 33 |
| BClocation not on record | 32 |
| Porvoo, FI | 32 |
| Uniwersytet Opolskilocation not on record | 32 |
| Pamplona, ES | 30 |
| Natural History Museum Rotterdamlocation not on record | 28 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 28 |
| Bern, CH | 27 |
| Tula State Universitylocation not on record | 27 |
| Entomological Society of Latvialocation not on record | 27 |
| Frankfurt am Main | 26 |
| Bronx, US | 26 |
| Burlington, US | 25 |
| Pullman, US | 25 |
| GJOlocation not on record | 24 |
| GZUlocation not on record | 22 |
| Uniwersytet Marii Curie-Skłodowskiejlocation not on record | 20 |
| San Sebastián, ES | 20 |
| Palacký University in Olomouclocation not on record | 16 |
| Ann Arbor, US | 16 |
| Pamplona, ES | 15 |
| TUR-Alocation not on record | 15 |
| PrivatHerblocation not on record | 14 |
| Dresden, DE | 14 |
| Fulda, DE | 14 |
| Montréal, CA | 13 |
| UGentlocation not on record | 13 |
| Philadelphia, US | 12 |
| University of New Hampshirelocation not on record | 12 |
| San Luis Obispo, US | 12 |
| PRClocation not on record | 12 |
| SWlocation not on record | 12 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 12 |
| MAlocation not on record | 12 |
| Toronto, CA | 11 |
| Porrentruy, CH | 11 |
| Madison, US | 10 |
| Brisbane, AU | 10 |
| Hudson, US | 10 |
| Philadelphia, US | 9 |
| Sede di Via Giorgio La Pira del Museo di Storia naturale di Firenze | Via Giorgio La Pira headquarter of the Natural History Museum in Florencelocation not on record | 9 |
| St. Paul, US | 9 |
| Dekalb, US | 8 |
| Tilburg, NL | 8 |
| Salamanca, ES | 8 |
| Museum of the Rockieslocation not on record | 8 |
| Stockholm, SE | 8 |
| Allentown, US | 8 |
| Nijmegen, NL | 7 |
| McWane Science Centerlocation not on record | 7 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 7 |
| WTUlocation not on record | 7 |
| València, ES | 7 |
| New Haven, US | 7 |
| Paris, FR | 7 |
| The State Museum-Preserve "The Kulikovo pole"location not on record | 7 |
| San Isidro, AR | 6 |
| Granada, ES | 6 |
| Bourges, FR | 6 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 6 |
| Uniwersytet Śląski w Katowicachlocation not on record | 6 |
| CICYTEXlocation not on record | 6 |
| OLAlocation not on record | 6 |
| Forssa, FI | 6 |
| SZUlocation not on record | 6 |
| The Tula Region State Institution of Culture "Tula Museum Association"location not on record | 6 |
| Podgorica, ME | 5 |
| Arcata, US | 5 |
| College of the Atlantic, Museumlocation not on record | 5 |
| Zürich, CH | 5 |
| Museo Entomologico de Leonlocation not on record | 4 |
| Bloomington, US | 4 |
| Denver, US | 4 |
| Missoula, US | 4 |
| Laboratory of Palaeontologylocation not on record | 4 |
| NMBU:MINAlocation not on record | 4 |
| University of Stellenboschlocation not on record | 4 |
| Tromso University Museumlocation not on record | 4 |
| Corvallis, US | 4 |
| John May Museum of Natural Historylocation not on record | 4 |
| Canadian Department of Agriculturelocation not on record | 4 |
| Madrid, ES | 4 |
| University of Copenhagen, Natural History Museum of Denmark, Herbarium Clocation not on record | 4 |
| Naturalis Biodiversity Centerlocation not on record | 4 |
| Kandalaksha State Nature Reservelocation not on record | 4 |
| Keene State Universitylocation not on record | 4 |
| CJBGlocation not on record | 4 |
| Kew, GB | 3 |
| Université Lavallocation not on record | 3 |
| Prioksko-Terrasnyi Biosphere Reservelocation not on record | 3 |
| University of Guelph, OAC Herbariumlocation not on record | 3 |
| H-Hohlalocation not on record | 3 |
| Rovaniemi, FI | 3 |
| Zürich, CH | 3 |
| Finnish Museum of Natural History, Botanical Museumlocation not on record | 3 |
| Winterthur, CH | 3 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 3 |
| nbflocation not on record | 3 |
| Wuzhou, CN | 3 |
| Bangkok, TH | 3 |
| Vancouver, CA | 3 |
| NBSIlocation not on record | 3 |
| Hamilton, US | 3 |
| New Brunswick, US | 3 |
| EL PASO, US | 2 |
| Salvador, BR | 2 |
| Monastir, TN | 2 |
| Logan, US | 2 |
| Flagstaff, US | 2 |
| Saint John, CA | 2 |
| Ivano-Frankove, UA | 2 |
| Oswego, US | 2 |
| Millersville, US | 2 |
| Canberra, AU | 2 |
| Bozeman, US | 2 |
| ASUlocation not on record | 2 |
| Staten Island, US | 2 |
| Lausanne, CH | 2 |
| BGBMlocation not on record | 2 |
| Victoria, CA | 2 |
| FLADlocation not on record | 2 |
| Trois-Rivières, CA | 2 |
| AUAlocation not on record | 2 |
| University of Genevalocation not on record | 2 |
| Taipei, TW | 2 |
| Hobart, AU | 2 |
| Sion, CH | 2 |
| ZRC-SAZUlocation not on record | 2 |
| Western Carolina Universitylocation not on record | 2 |
| Christchurch, NZ | 2 |
| Saint Louis, US | 2 |
| College Park, US | 2 |
| Xiamen, CN | 2 |
| Sevilla, ES | 1 |
| Museo della Bonifica di San Donà di Piavelocation not on record | 1 |
| DOI/NPS, Mount Rainier National Parklocation not on record | 1 |
| Minia, EG | 1 |
| POL003location not on record | 1 |
| Auckland, NZ | 1 |
| Garðabær, IS | 1 |
| Fundación Miguel Lillolocation not on record | 1 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 1 |
| H-Dunkellocation not on record | 1 |
| SVN019location not on record | 1 |
| Museo Achille Folettolocation not on record | 1 |
| Tampa, US | 1 |
| Mount Annan, AU | 1 |
| Davis, US | 1 |
| Santa Barbara, US | 1 |
| Göteborg, SE | 1 |
| Brussel, BE | 1 |
| Portland, US | 1 |
| Durham, US | 1 |
| Provo, US | 1 |
| Harrisonburg, US | 1 |
| Badajoz, ES | 1 |
| Chapel Hill, US | 1 |
| Portland, US | 1 |
| Columbia, US | 1 |
| SGAV-and-NHMDlocation not on record | 1 |
| Bend, US | 1 |
| LUXEMBOURG, LU | 1 |
| Alicante, ES | 1 |
| Acadia Universitylocation not on record | 1 |
| München, DE | 1 |
| Kagoshima, JP | 1 |
| Herbario Universidad de Concepciónlocation not on record | 1 |
| Mohonk Preservelocation not on record | 1 |
| Morgantown, US | 1 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 1 |
| Namur, BE | 1 |
| Ashland, US | 1 |
| Herb. BBGlocation not on record | 1 |
| B.A. Bennett Herbariumlocation not on record | 1 |
| Blacksburg, US | 1 |
| Jaén, ES | 1 |
| Tacoma, US | 1 |
| Fort Worth, US | 1 |
| Chicago, US | 1 |
| M-VascularPlantslocation not on record | 1 |
| Musée des Confluenceslocation not on record | 1 |
| Adelaide, AU | 1 |
| UoB-IBlocation not on record | 1 |
| Central Botanical Gardenlocation not on record | 1 |
| Whitehorse, CA | 1 |
| Cheney, US | 1 |
| Mississippi State, US | 1 |
| University of Alberta Museumslocation not on record | 1 |
232 institutions · 18 358 of 20 053 vouchered records shown · 1 515 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA31 detections
Where the DNA of Centaurea jacea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found31
Studies independent surveys1
Countries8
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 31 detections have coordinates
Open the map8 countries0
Disturbed areas near construction site.
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median15.8 °C 10.2–17.2
Seasonal swing summer↔winter18.8 °C
Max temp (day)18.5 °C 13.7–20.7
Min temp (night)11.5 °C 7.10–14.5
Precipitation81.4 mm/mo 64.9–107
Air humidity62.7 % 58.7–65.3
Moisture balance-16.9 mm/mo -43.9–24.2
Vapour deficit688 Pa 481–769
Wind speed3.40 m/s 2.40–5.20
Cloud cover48.1 % 38.9–63.6
CHELSA 1981–2010, ~9 km grid, at location & month of 22 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.