Centaurea horrida

Badarò · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Centaurea

At a glance

Occurrence records86

Data sources8

Biological traits0

DNA specimens4

eDNA detections3

Sources8 archives

Databases and archives Centaurea horrida's data was compiled from.

GBIFGlobal Biodiversity Information Facility86 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Chemical compositionNPASS17 compounds

Occurrence & distributionGBIF86 records

Environmental DNA1 datasets · 0 countries3 detections

DNA & barcodingBOLD · NCBI4 specimens

Genome at a glanceCCDB2n = 18

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition17 compounds

Compounds documented for Centaurea horrida across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Ursane and Taraxastane triterpenoids4

Flavonols4

Lupane triterpenoids2

Simple phenolic acids2

Stigmastane steroids2

Documented compounds17 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Ursolic Acid	present	NPASS
[(3S,4aR,6aR,6aR,6bR,8aR,12S,12aR,14aR,14bR)-4,4,6a,6b,8a,11,12,14b-octamethyl-9-oxo-1,2,3,4a,5,6,6a,7,8,12,12a,13,14,14a-tetradecahydropicen-3-yl] acetate	present	NPASS
Alpha-Amyrin	present	NPASS
alpha-Amyrin acetate	present	NPASS
Beta-Amyrone	present	NPASS
beta-Sitosterol	present	NPASS
Betulinic Acid	present	NPASS
Feruloyl isoquercitrin 4'-glucoside	present	NPASS
Hexacosan-1-ol	present	NPASS
Kaempferol 3-O-neohesperidoside	present	NPASS

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Centaurea horrida has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes1

GenBank sequences10

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKF630431.1 ↗633 bpItaly

ACGT

TCGAAGCCTGCACAGCAGAACGACCCGTGAACATGTAATCACAACCGGGTGTCGTGGGGTCGGGTGCGAGCCTTAGCCCTGCGATGCTCG …

Centaurea horrida clone TAV3 1 internal transcribed species 1 gene, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Centaurea horrida carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidydiploid inferred

Chromosome records18–182n range18median18mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 183×CCDB · ita-fl · CCDB · Cave1956supp

CCDB · ita-fl — DESOLE L. - 1954. Secondo contributo alla conoscenza dello sviluppo embriologico del genere "Centaurea" L. (Asteraceae). "Centaurea horrida" Bad.. N. Giorn. Bot. Ital. , 61(2-3): 256-273.

CCDB · ita-fl — DESOLE L. - 1954. Eterofillia e relativa morfologia in "Centaurea horrida" Bad.. N. Giorn. Bot. Ital. , 61(2-3): 239-248.

CCDB · Cave1956supp — Desole 1955

n 93×CCDB · ita-fl · CCDB · Cave1956supp

CCDB · ita-fl — DESOLE L. - 1954. Eterofillia e relativa morfologia in "Centaurea horrida" Bad.. N. Giorn. Bot. Ital. , 61(2-3): 239-248.

CCDB · Cave1956supp — Desole 1955

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type86 records

Wild obs. + sensor50

Museum / vouchered14

Other22

Range

Area of Occupancy AOO196 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy38% within 1 km

≤100 m 2≤1 km 12>10 km 23

37 georeferenced · 13 without coordinates

Open the mapobservation + sensor50

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced · 13 without coordinates

Open the institutions mapphysical evidence14

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
BIO-UNIPIlocation not on record	11
Berlin, DE	2
Wlocation not on record	1

3 institutions · 14 of 14 vouchered records shown

09Environmental DNA3 detections

Where the DNA of Centaurea horrida was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)