Centaurea eriophora

species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Centaurea

At a glance

Occurrence records270

Data sources11

Biological traits31

DNA specimens1

eDNA detections1

Sources11 archives

Databases and archives Centaurea eriophora's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility270 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

Paleobiology DatabasePBDB consortiumfossil record↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources31 traits

Chemical compositionLOTUS · NPASS7 compounds

Occurrence & distributionGBIF270 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 24

01Narrative

Centaurea eriophora (лат.) — вид однолетних травянистых растений рода василёк (Centaurea) семейства астровые (Asteraceae). Прямые стебли растения достигают 15 — 70 см в высоту. Цветки жёлтые. Период цветения: апрель. Произрастает на лугах в Израиле, Испании, южной Португалии, Алжире, Марокко, Тунисе.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAusTraitsWCVPTRYGIFT

Size & morphology10

Fruit length4.25 mm

Fruit length max5 mm

Fruit length min4 mm

Fruit width max2.5 mm

Fruit width min2 mm

Leaf length120 mm

Leaf length max150 mm

Leaf width max40 mm

Plant height0.4 m

Plant height max0.5 m

Life cycle & reproduction9

Dehiscenceindehiscent

Dispersal typewind

Flower colouryellow

Flower length max19 mm

Flower length min13 mm

Flowering endMay

Flowering startApr

Life spanannual biennial

⚠ sources differ — AusTraits: annual biennial · GIFT: annual

Raunkiær life formtherophyte

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max600 m

Epiphyteterrestrial

Fruit typeachene

Growth formherb

Leaf formelliptic

Leaf shapelanceolate spathulate

Woodinessnon-woody

Other traits1

Shoot orientationerect

03Chemical composition7 compounds

Compounds documented for Centaurea eriophora across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile4 classes

Fatty aldehydes2

Phenylethylamines2

Fatty alcohols $ Fatty aldehydes2

Amarylidaceae alkaloids $ Phenylethylamines1

Documented compounds7 total

Tissue Source Quantified only

Compound	Amount	Source
1,11-Tridecadiene-3,5,7,9-tetrayne	present	LOTUS
3,4-Dimethoxyphenylethylamine	present	NPASS
6,8,10,12-Pentadecatetraenal	present	LOTUS
Magnosprengerine	present	NPASS
N-Methylhomoveratrylamine	present	NPASS
Pentadeca-6,8,10,12-tetraenal	present	LOTUS
Trideca-1,11-dien-3,5,7,9-tetrayn	present	LOTUS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Centaurea eriophora has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences2

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSAM087158.1 ↗215 bpMorocco

ACGT

ATCGCGTCGCCCCAGACCAAGCTCCCCCATAGGGACGTTGGTTTGGGACGGAGATTGGTCTCCCGTGCCGATGGTGTGGTTGGCCTAAAA …

Centaurea eriophora ITS2, specimen voucher Lippert 22982 (M)

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS2★ITS2

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Centaurea eriophora carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 24 n = 12

Ploidydiploid inferred

Chromosome records24–242n range24median24mode9records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 249×CCDB · iber-fl · CCDB · fl-europaea · CCDB · ipcn-api-dl +4

CCDB · iber-fl — Chromosome numbers in Iberian angiosperms. Bjorkqvist, I. & al.Bot. Not.122: 271-283(1969).

CCDB · iber-fl — Nmeros cromosmicos para la flora espaola, 603-617. Gallego, M. J. & A. Aparicio.Lagascalia15(2): 288-295(1990).

CCDB · fl-europaea — Bjbrkqvist et al.

CCDB · ipcn-api-dl — Gallego, M. J. & A. Aparicio. 1990. Números cromosómicos para la flora Española. 603--617. Lagascalia 15: 288–295.

CCDB · book-ipcn67-71 — BJ.ORKQVIST, I . , R. VON BOTHMER, O. NILSSON: & B. NORDENSTAM. 1969. Chromosome numbers in Iberian Angiosperms. Bot. Notiser 122: 271-28;

CCDB · book-ipcn73-74 — POWELL, A.M., D.W. KYHOS, & P.H. RAVEN. 1974. Chromosome numbers in Compositae. X. Amer. J. Bot. 61: 909-913.

CCDB · Cave1962 — Guinochet & F. 1962

CCDB · CromoCat 2015 — Björkqvist, I., von Bothmer, R., Nilsson, O. & Nordenstam, B. (1969). Chromosome numbers in Iberian angiosperms. Bot. Not. 122: 271-283.

CCDB · CromoCat 2015 — Gallego, M. J. & Aparicio, A. (1990). Chromosome numbers for the Spanish flora: Numbers 603-617. Lagascalia 15(2): 288-295.

n 121×CCDB · CromoCat 2015

CCDB · CromoCat 2015 — Powell, A. M., D. W. Kyhos & P. H. Raven. (1974). Chromosome numbers in Compositae. X. Amer. J. Bot. 61: 909-913.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=0.452 ↗

08Occurrence & distribution

Record type270 records

Wild obs. + sensor157

Museum / vouchered113

Origin

Native44

Range

Area of Occupancy AOO676 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy62% within 1 km

≤100 m 28≤1 km 55≤10 km 49>10 km 2

134 georeferenced · 23 without coordinates

Open the mapobservation + sensor157

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy57% within 1 km

≤100 m 3≤1 km 36≤10 km 29>10 km 1

69 georeferenced · 44 without coordinates

Open the institutions mapphysical evidence113

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions15 of 27 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
BClocation not on record	21
Museo della Bonifica di San Donà di Piavelocation not on record	10
Córdoba, ES	9
College of the Atlantic, Museumlocation not on record	6
Alicante, ES	6
Adelaide, AU	6
Sevilla, ES	5
Jaén, ES	5
Granada, ES	5
Barcelona, ES	5
Paris, FR	3
Wlocation not on record	3
CICYTEXlocation not on record	3
Phyletisches Museum Jenalocation not on record	3
MAlocation not on record	3
Podgorica, ME	2
LDlocation not on record	2
Canberra, AU	2
Museo Entomologico de Leonlocation not on record	2
València, ES	2
Entomological Society of Latvialocation not on record	2
Vitoria, ES	1
Ensenada, MX	1
Institut und Museum fuer Geologie und Palaeontologielocation not on record	1
Salamanca, ES	1
Canadian Department of Agriculturelocation not on record	1
Badajoz, ES	1

27 institutions · 111 of 113 vouchered records shown · 1 without an institution code

09Environmental DNA1 detections

Where the DNA of Centaurea eriophora was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.2 °C 24.2–24.2

Seasonal swing summer↔winter19.5 °C

Max temp (day)31.4 °C

Min temp (night)16.2 °C

Precipitation4.40 mm/mo

Air humidity43.8 %

Moisture balance-164 mm/mo

Vapour deficit1,848 Pa

Wind speed4.30 m/s

Cloud cover22.6 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)