Centaurea diffusa
Lam. · speciesAt a glance
Occurrence records9 219
Data sources13
Biological traits48
DNA specimens91
eDNA detections29
Sources13 archives
Databases and archives Centaurea diffusa's data was compiled from.
WikipediaWikimedia Foundation8 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility9 219 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI29 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics91 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources48 traits
Chemical compositionLOTUS · NPASS86 compounds
Occurrence & distributionGBIF9 219 records
Environmental DNA1 datasets · 7 countries29 detections
DNA & barcodingBOLD · NCBI91 specimens
Genome at a glanceCCDB2n = 18
01Narrative
Centaurea diffusa, also known as diffuse knapweed, white knapweed or tumble knapweed, is a member of the genus Centaurea in the family Asteraceae. This species is common throughout western North America but is not actually native to the North American continent, but to the eastern Mediterranean.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTLEDATRYWCVP
Size & morphology17
Fruit length2 mm
Fruit length max2 mm
Fruit length min2 mm
Fruit width1 mm
Fruit width max1 mm
Fruit width min1 mm
Leaf mass15.07 mg
Leaf size225 mm²
Leaf width max3 mm
Leaf width min1 mm
Plant height0.3 m
⚠ sources differ — GIFT: 0.3 m · LEDA: 0.3 m · TRY: 0.386 m
Plant height generative0.35 m
Plant height max0.6 m
Plant height min0.1 m
Seed mass3.34 mg
Seed mass max3.34 mg
Seed mass min3.34 mg
Life cycle & reproduction12
Deciduousnessdeciduous
Dispersal typeself
⚠ sources differ — LEDA: chamaechor · GIFT: anemochorous
Flowering endOct
Flowering startJul
Life formbiennial
Life spanperennial
⚠ sources differ — TRY: perennial · LEDA: summer annuals · GIFT: biennial
Lifespan years2 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formtherophyte
Seed number56
Self fertilizationpresent
Diet & foraging1
Parasiteindependent
Habitat & environment10
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max500 m
Elevation min0 m
Epiphyteterrestrial
Growth formherb
Habitat GIFTmountains, sand, sea, shores, stony places
Mycorrhiza typearbuscular
Woodinessnon-woody
Physiology & chemistry7
Leaf C:N ratio26.98 g/g
Leaf c444 mg/g
Leaf dry-matter content (LDMC)215 mg/g
⚠ sources differ — TRY: 215 mg/g · LEDA: 203 mg/g
Leaf n16.98 mg/g
Leaf p1.81 mg/g
Photosynthetic pathwayC3
Specific leaf area (SLA)15.77 mm²/mg
Other traits1
Diaspore typefruit
03Chemical composition86 compounds
Compounds documented for Centaurea diffusa across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Spirostane steroids15
Furostane steroids12
Friedelane triterpenoids2
Stigmastane steroids2
Flavones2
Documented compounds86 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (22r)-22-Hydroxycholes-terol | present | NPASS | |
| (2R,3R,4S,5S,6R)-2-[(2R)-4-[(1R,2R,4S,6R,7S,8R,9S,12S,13R,14R,16R)-14-[(2R,3R,4S,5R,6R)-3-[(2S,3R,4R,5S,6S)-3,5-dihydroxy-6-methyl-4-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxan-2-yl]oxy-4,5-dihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-16-hydroxy-6-methoxy-7,9,13-trimethyl-5-oxapentacyclo[10.8.0.02,9.04,8.013,18]icos-18-en-6-yl]-2-methylbutoxy]-6-(hydroxymethyl)oxane-3,4,5-triol | present | NPASS | |
| (2R,3S,4S,5R,6R)-2-(hydroxymethyl)-6-[[(2R,3S,4S,5R,6S)-3,4,5-trihydroxy-6-[(1S,2S,3'S,4S,5'R,6S,7S,8R,9S,12S,13R,16S)-16-hydroxy-5',7,9,13-tetramethylspiro[5-oxapentacyclo[10.8.0.02,9.04,8.013,18]icos-18-ene-6,2'-oxane]-3'-yl]oxyoxan-2-yl]methoxy]oxane-3,4,5-triol | present | NPASS | |
| (2S,3R,4R,5R,6S)-2-[(2R,3R,4S,5R,6R)-4,5-dihydroxy-2-[[(1R,2R,4S,6R,7S,8R,9S,12S,13R,14R,16R)-16-hydroxy-6-methoxy-7,9,13-trimethyl-6-[(3R)-3-methyl-4-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxybutyl]-5-oxapentacyclo[10.8.0.02,9.04,8.013,18]icos-18-en-14-yl]oxy]-6-(hydroxymethyl)oxan-3-yl]oxy-6-methyloxane-3,4,5-triol | present | NPASS | |
| (2S,3R,4R,5R,6S)-2-[(2R,3R,4S,5R,6R)-4,5-dihydroxy-6-(hydroxymethyl)-2-[(1R,2S,4S,5'R,6R,7S,8R,9S,12R,13R,14R,16R)-16-hydroxy-5',7,9,13-tetramethylspiro[5-oxapentacyclo[10.8.0.02,9.04,8.013,18]icos-18-ene-6,2'-oxane]-14-yl]oxyoxan-3-yl]oxy-6-methyloxane-3,4,5-triol | present | NPASS | |
| (2S,3R,4R,5R,6S)-2-[(2S,3R,4S,5S)-2-[[(1S,2S,4S,6R,7S,8R,9S,12S,13R,14R,16R)-6,16-dihydroxy-7,9,13-trimethyl-6-[(3R)-3-methyl-4-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxybutyl]-5-oxapentacyclo[10.8.0.02,9.04,8.013,18]icos-18-en-14-yl]oxy]-4,5-dihydroxyoxan-3-yl]oxy-6-methyloxane-3,4,5-triol | present | NPASS | |
| (2S,3R,4R,5R,6S)-2-[(2S,3R,4S,5S)-2-[[(1S,2S,4S,6R,7S,8R,9S,12S,13R,14R,16R)-6,16-dihydroxy-7,9,13-trimethyl-6-[3-[[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxymethyl]but-3-enyl]-5-oxapentacyclo[10.8.0.02,9.04,8.013,18]icos-18-en-14-yl]oxy]-4,5-dihydroxyoxan-3-yl]oxy-6-methyloxane-3,4,5-triol | present | NPASS | |
| (2S,3R,4R,5R,6S)-2-[(2S,3R,4S,5S)-4,5-dihydroxy-2-[(1S,2S,4S,5'R,6R,7S,8R,9S,12S,13R,14R,16R)-16-hydroxy-5',7,9,13-tetramethylspiro[5-oxapentacyclo[10.8.0.02,9.04,8.013,18]icos-18-ene-6,2'-oxane]-14-yl]oxyoxan-3-yl]oxy-6-methyloxane-3,4,5-triol | present | NPASS | |
| (2S,3R,4R,5R,6S)-2-[(2S,3R,4S,5S)-4,5-Dihydroxy-2-[(1S,2S,4S,6R,7S,8R,9S,12S,13R,14R,16R)-16-hydroxy-7,9,13-trimethyl-5'-methylidenespiro[5-oxapentacyclo[10.8.0.02,9.04,8.013,18]icos-18-ene-6,2'-oxane]-14-yl]oxyoxan-3-yl]oxy-6-methyloxane-3,4,5-triol | present | NPASS | |
| (2S,3R,4R,5R,6S)-2-[(2S,3R,4S,5S)-4,5-dihydroxy-2-[[(1S,2S,4S,6R,7S,8R,9S,12S,13R,14R,16R)-16-hydroxy-6-methoxy-7,9,13-trimethyl-6-[3-[[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxymethyl]but-3-enyl]-5-oxapentacyclo[10.8.0.02,9.04,8.013,18]icos-18-en-14-yl]oxy]oxan-3-yl]oxy-6-methyloxane-3,4,5-triol | present | NPASS |
05DNA & barcoding91 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Centaurea diffusa has left across the world's sequence archives.
At a glance
DNA specimens91
Marker genes6
GenBank sequences10
eDNA detections29
Countries8
The DNA barcodea real sequence read deposited for this species
CAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATTCGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGC …
Centaurea diffusa voucher CCDB-18322-E7 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK1★rbcL1★rbcLa★ITS8★ITS2trnH-psbA
plant barcodefungal barcodemarker
06Genome at a glanceCCDB
The complete instruction manual Centaurea diffusa carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 18 n = 9
Ploidydiploid inferred
Chromosome records16–182n range18median18mode22records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 1820×CCDB · slov-fl · CCDB · iapt · CCDB · ipcn-api-dl +3
CCDB · slov-fl — Májovský J. et al., 1978: Index of chromosome numbers of Slovakian flora (Part 6). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 26: 1-42.
CCDB · slov-fl — Uhríková A. & Májovský J., 1978: [Report], pp. 378-379. - In: Löve Á. (ed.), IOPB Chromosome Number Reports LXI, Taxon 27 /4.
CCDB · slov-fl — Uhríková A. & Májovský J., 1977: [Report], pp. 263. - In: Löve Á. (ed.), IOPB Chromosome number reports LVI, Taxon 26 /2-3.
CCDB · slov-fl — Španiel S., 2007: [New records in Centaurea], pp. 179, 181-183. - In: Marhold K., Mártonfi P., Mereďa P. jun., Mráz P. (eds), Chromosome number survey of the ferns and flowering plants of Slovakia. Veda, Bratislava.
CCDB · iapt — IAPT/IOPB Chromosome Data 8
CCDB · iapt
CCDB · ipcn-api-dl — Dmitrieva, S. A. & V. I. Parfenov. 1983. Khromosomnye chisla nekotorykh vidov flory Belorussii. Izv. Akad. Nauk Belorussk. SSR, Ser. Biol. Nauk 2: 7–12.
CCDB · ipcn-api-dl — Georgiadis, T. 1980. Contribution à l'étude phylogénétique du genre Centaurea L. (Sectio Acrolophus (Cass.) DC.) en Grèce. Thesis, Universit;aae de Provence. Aix Marseilles. ý.
CCDB · ipcn-api-dl — Taylor, R. L. & S. Taylor. 1977. Chromosome numbers of vascular plants of British Columbia. Syesis 10: 125–138.
CCDB · ipcn-api-dl — Morton, J. K. 1981. Chromosome numbers in Compositae from Canada and the U.S.A. Bot. J. Linn. Soc. 82: 357–368.
CCDB · ipcn-api-dl — Tonian, T. R. 1980. Relation between chromosome number and some morphological features of Centaureinae Less representatives. Rev. Biol. 33 (5): 552–554.
CCDB · ipcn-api-dl — Kuzmanov, B., D. Ninova & S. Georgieva. 1979. In IOPB chromosome number reports LXIV. Taxon 28:408.
CCDB · ipcn-api-dl — Kuzmanov, B., D. Ninova & S. Georgieva. 1981c. In Chromomsome number reports LXXII. Taxon 30:702.
CCDB · ipcn-api-dl — Uhrikova, A. 1978. In Index of chromosome numbers of Slovakian flora. Part 6. Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 26: 1–42.
CCDB · ipcn-api-dl — Kralik, E. 1978. In Index of chromosome numbers of Slovakian flora. Part 6. Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 26: 1–42.
CCDB · book-ipcn73-74 — POWELL, A.M., D.W. KYHOS, & P.H. RAVEN. 1974. Chromosome numbers in Compositae. X. Amer. J. Bot. 61: 909-913.
CCDB · book-atlas-flowering-plants — Moore & F. 1954
CCDB · Cave1962 — Guinochet & F. 1962
CCDB · iapt — IAPT/IOPB Chromosome Data 31
2n 162×CCDB · ipcn-api-dl · CCDB · kew
CCDB · ipcn-api-dl — Bancheva, S. & J. Greilhuber. 2006. Genome size in Bulgarian Centaurea s.l. (Asteraceae). Pl. Syst. Evol. 257: 95–117.
CCDB · kew — Bancheva S, Greilhuber J. 2006. Genome size in Bulgarian Centaurea s.l. (Asteraceae). Plant Systematics and Evolution 257: 95-117.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
07Deep time~2.37 Ma lineage
How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.
At a glance
DNA clock origin2.37 Ma TimeTree
When this lineage existed
How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.
DNA clock origin
08Occurrence & distribution
Record type9 219 records
Wild obs. + sensor7 200
Museum / vouchered1 972
Other47
Origin
Native8
Introduced1 461
Range
Area of Occupancy AOO19 200 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy86% within 1 km
≤100 m 2 923≤1 km 980≤10 km 507>10 km 150
4 560 georeferenced · 2 640 without coordinates
Open the mapobservation + sensor7 200
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy65% within 1 km
≤100 m 228≤1 km 376≤10 km 313>10 km 13
930 georeferenced · 1 042 without coordinates
Open the institutions mapphysical evidence1 972
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions85 of 158 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Moscow State Universitylocation not on record | 187 |
| Vancouver, CA | 106 |
| Canadian Department of Agriculturelocation not on record | 88 |
| Denver, US | 66 |
| WTUlocation not on record | 62 |
| Victoria, CA | 51 |
| Adam Mickiewicz University in Poznańlocation not on record | 50 |
| Pullman, US | 49 |
| Berlin, DE | 46 |
| BRNUlocation not on record | 44 |
| Bronx, US | 42 |
| Corvallis, US | 36 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 29 |
| Flagstaff, US | 28 |
| Uniwersytet Wrocławskilocation not on record | 28 |
| Görlitz, DE | 27 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 27 |
| LDlocation not on record | 25 |
| Logan, US | 19 |
| Wuzhou, CN | 15 |
| Bozeman, US | 14 |
| IDElocation not on record | 13 |
| Philadelphia, US | 12 |
| San Luis Obispo, US | 12 |
| Provo, US | 11 |
| Riverside, US | 10 |
| Uniwersytet Śląski w Katowicachlocation not on record | 9 |
| Chadron, US | 8 |
| ASUlocation not on record | 8 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 7 |
| SLU Artdatabankenlocation not on record | 7 |
| Tartu, EE | 7 |
| Mlocation not on record | 6 |
| Wlocation not on record | 6 |
| Claremont, US | 6 |
| Olocation not on record | 6 |
| Albuquerque, US | 6 |
| Saint Louis, US | 6 |
| Córdoba, AR | 6 |
| Boise, US | 6 |
| BIO-UNIPIlocation not on record | 6 |
| Missoula, US | 6 |
| Phoenix, US | 5 |
| Chongqing Museumlocation not on record | 5 |
| Whitehorse, CA | 5 |
| MeiseBGlocation not on record | 5 |
| Oulu, FI | 5 |
| DOI/NPS, Greenbelt Parklocation not on record | 5 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 5 |
| Davis, US | 5 |
| Tacoma, US | 4 |
| Agriculture and Agri-Food Canada, Vascular Plant Herbariumlocation not on record | 4 |
| València, ES | 4 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 4 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 4 |
| San Diego, US | 4 |
| Henderson, US | 4 |
| Université Lavallocation not on record | 4 |
| Samara National Research Universitylocation not on record | 4 |
| Bern, CH | 4 |
| Portland, US | 4 |
| Arcata, US | 4 |
| BFLlocation not on record | 4 |
| WINlocation not on record | 4 |
| USFSlocation not on record | 4 |
| Oskarshamn, SE | 3 |
| Department of Bacteriology, University of Wisconsinlocation not on record | 3 |
| Podgorica, ME | 3 |
| Finnish Museum of Natural History, Botanical Museumlocation not on record | 3 |
| Moscow, US | 3 |
| Pocatello, US | 3 |
| DOI/NPS, Mount Rainier National Parklocation not on record | 3 |
| Caldwell, US | 3 |
| Emporia, US | 3 |
| Research Collection of B. A. Bennettlocation not on record | 3 |
| Angwin, US | 3 |
| Santa Barbara, US | 3 |
| St. Paul, US | 3 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 3 |
| DULlocation not on record | 3 |
| Ann Arbor, US | 3 |
| McWane Science Centerlocation not on record | 3 |
| Trois-Rivières, CA | 2 |
| Barcelona, ES | 2 |
| John May Museum of Natural Historylocation not on record | 2 |
| Kew, GB | 2 |
| Madison, US | 2 |
| University of New Hampshirelocation not on record | 2 |
| The Tula Region State Institution of Culture "Tula Museum Association"location not on record | 2 |
| MAlocation not on record | 2 |
| South Kensington, GB | 2 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 2 |
| CICYTEXlocation not on record | 2 |
| KNFHClocation not on record | 2 |
| Paris, FR | 2 |
| Entomological Society of Latvialocation not on record | 2 |
| San Isidro, AR | 2 |
| CASlocation not on record | 2 |
| Kuopio, FI | 2 |
| Museo Achille Folettolocation not on record | 2 |
| Granada, ES | 2 |
| Burlington, US | 2 |
| Macomb, US | 2 |
| BClocation not on record | 2 |
| SEFlocation not on record | 1 |
| Laboratorio de Ictiologialocation not on record | 1 |
| H-Meierottlocation not on record | 1 |
| Bend, US | 1 |
| GZUlocation not on record | 1 |
| Stockholm, SE | 1 |
| Bangkok, TH | 1 |
| Toronto, CA | 1 |
| PRClocation not on record | 1 |
| Natural History Museum Rotterdamlocation not on record | 1 |
| Keene State Universitylocation not on record | 1 |
| Ashland, US | 1 |
| Feira de Santana, BR | 1 |
| Monastir, TN | 1 |
| Cheney, US | 1 |
| Corrientes, AR | 1 |
| US | 1 |
| CJBGlocation not on record | 1 |
| Austin, US | 1 |
| Universität Erlangen-Nürnberglocation not on record | 1 |
| Meguro Parasitological Museumlocation not on record | 1 |
| University of Stellenboschlocation not on record | 1 |
| Bothell, US | 1 |
| Museum of the Rockieslocation not on record | 1 |
| Frankfurt am Main | 1 |
| Lincoln, US | 1 |
| Dekalb, US | 1 |
| Dresden, DE | 1 |
| Phyletisches Museum Jenalocation not on record | 1 |
| Pamplona, ES | 1 |
| Jena Microbial Resource Collectionlocation not on record | 1 |
| Vitoria, ES | 1 |
| BSBIlocation not on record | 1 |
| Montréal, CA | 1 |
| New Haven, US | 1 |
| Clemson, US | 1 |
| Clocation not on record | 1 |
| Madrid, ES | 1 |
| TROMlocation not on record | 1 |
| STNFlocation not on record | 1 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 1 |
| Provincia di Livornolocation not on record | 1 |
| Turku, FI | 1 |
| Columbia, US | 1 |
| University of British Columbialocation not on record | 1 |
| College of the Atlantic, Museumlocation not on record | 1 |
| Salamanca, ES | 1 |
| Lausanne, CH | 1 |
| Durango, US | 1 |
| US | 1 |
| IWEP FEB RASlocation not on record | 1 |
| IPA/SPlocation not on record | 1 |
| Bandelier National Monumentlocation not on record | 1 |
| EL PASO, US | 1 |
158 institutions · 1 452 of 1 972 vouchered records shown · 519 without an institution code
09Environmental DNA29 detections
Where the DNA of Centaurea diffusa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found29
Studies independent surveys1
Countries7
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 29 detections have coordinates
Open the map7 countries0
Railway yard.Disturbed rangeland.
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median13.7 °C 3.80–18.1
Seasonal swing summer↔winter23.9 °C
Max temp (day)18.3 °C 7.20–24.7
Min temp (night)9.90 °C 0.1–12.9
Precipitation61.7 mm/mo 24.5–94.4
Air humidity62.2 % 50.7–64.0
Moisture balance-20.5 mm/mo -87.9–19.2
Vapour deficit653 Pa 356–998
Wind speed2.80 m/s 1.40–5.70
Cloud cover43.4 % 32.6–53.2
CHELSA 1981–2010, ~9 km grid, at location & month of 12 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.