Centaurea cyanus
speciesAt a glance
Occurrence records147 456
Data sources15
Biological traits65
DNA specimens45
eDNA detections26
Sources15 archives
Databases and archives Centaurea cyanus's data was compiled from.
WikipediaWikimedia Foundation17 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility147 456 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI26 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics45 specimens↗
NCBIUS National Library of Medicinesequences↗
dukesphytochemcompounds
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
Paleobiology DatabasePBDB consortiumfossil record↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources65 traits
Chemical compositionDukesPhytochem · LOTUS · NPASS126 compounds
Occurrence & distributionGBIF147 456 records
Environmental DNA2 datasets · 7 countries26 detections
DNA & barcodingBOLD · NCBI45 specimens
Genome at a glanceCCDB · GoaT782 Mbp
01Narrative
Centaurea cyanus, commonly known as cornflower or bachelor's button, is an annual flowering plant in the family Asteraceae native to Europe. In the past, it often grew as a weed in cornfields (in the broad sense of "corn", referring to grains, such as wheat, barley, rye, or oats), hence its name. It is now endangered in its native habitat by agricultural intensification, particularly by over-use of herbicides. However, Centaurea cyanus is now also naturalised in many other parts of the world, including North America and parts of Australia through introduction as an ornamental plant in gardens and as a seed contaminant in crop seeds.[1]. Daylilies in Australia, May 17, 2021
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTAusTraitsLEDATRYWCVP
Size & morphology25
Fruit length3 mm
Fruit length max3 mm
Fruit length min3 mm
Fruit width1.5 mm
Fruit width max1.5 mm
Fruit width min1.5 mm
Leaf length45 mm
⚠ sources differ — AusTraits: 45 mm · GIFT: 65 mm
Leaf length max110 mm
Leaf length min40 mm
Leaf mass44.12 mg
Leaf size488 mm²
Leaf width3.5 mm
⚠ sources differ — AusTraits: 3.5 mm · GIFT: 6 mm
Leaf width max8 mm
Leaf width min2 mm
Plant height0.573 m
⚠ sources differ — GIFT: 0.573 m · AusTraits: 0.8 m · LEDA: 0.618 m · TRY: 0.537 m
Plant height generative0.583 m
Plant height max1 m
Plant height min0.15 m
Seed length3.17 mm
Seed mass3.95 mg
⚠ sources differ — TRY: 3.95 mg · LEDA: 4.75 mg · GIFT: 5.6 mg
Seed mass max5.7 mg
Seed mass min2.33 mg
Seed volume3.9 mm³
Seed volume max3.9 mm³
Seed volume min3.9 mm³
Life cycle & reproduction15
Deciduousnessevergreen
Dehiscenceindehiscent
Dispersal typeanimal
⚠ sources differ — LEDA: epizoochor · GIFT: anemochorous
Flowering endOct
Flowering startJun
Flowering timennnnnnnnyyyn
Life formannual
Life spanannual
⚠ sources differ — TRY: summer annuals · AusTraits: annual biennial · LEDA: summer annuals · GIFT: annual
Lifespan years1 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formtherophyte
Reproduction asexualabsent
Seed number1 150
Self fertilizationpresent
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment15
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max1 400 m
Elevation mean2 620 m
Elevation min0 m
Epiphyteterrestrial
Fruit fleshinessdry
Fruit typeachene
Growth formherb
⚠ sources differ — GIFT: herb · AusTraits: herb · TRY: forb-annual
Habitat GIFT(?) open, roadside
Leaf compoundnesssimple
Leaf shapelanceolate linear
Mycorrhiza typearbuscular
Woodinessnon-woody
Physiology & chemistry7
Leaf C:N ratio26.7 g/g
Leaf c463 mg/g
Leaf dry-matter content (LDMC)180 mg/g
Leaf n16.86 mg/g
Photosynthetic pathwayC3
Seed longevity index0.5
Specific leaf area (SLA)29.61 mm²/mg
⚠ sources differ — TRY: 29.61 mm²/mg · LEDA: 21.06 mm²/mg · GIFT: 21.06 mm²/mg
Other traits1
Diaspore typeone-seeded generative dispersule
03Chemical composition126 compounds
Compounds documented for Centaurea cyanus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
🍽 Used in cooking💊 Medicinal use documented
Compound class profile5 classes
Flavones10
Cinnamic acid amides9
Cinnamic acids and derivatives7
Flavonols7
Anthocyanidins3
Documented compounds126 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| PROTEIN | 254,000 ppm | DukesPhytochem | |
| FAT | 181,000 ppm | DukesPhytochem | |
| CYANOCENTAURIN | 975 ppm | DukesPhytochem | |
| PROTOCYANIN | 11.6 ppm | DukesPhytochem |
05DNA & barcoding45 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Centaurea cyanus has left across the world's sequence archives.
At a glance
DNA specimens45
Marker genes6
GenBank sequences10
eDNA detections26
Countries8
The DNA barcodea real sequence read deposited for this species
ACGCATCGCGTCGCCCCAGACCATGCTCCCACTTGGGATGTGTTTGGTTTGGGACGGAGATTGGTCTCCCGTGCCTATGGTGCGGTTTGC …
Centaurea cyanus voucher ZX-4215 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★COI-5P★matK1★rbcL2★rbcLa★ITS7★ITS2
animal barcodeplant barcodefungal barcode
06Genome at a glanceCCDB · GoaT
The complete instruction manual Centaurea cyanus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size782 400 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Centaurea cyanus0.78 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 24 n = 12
Ploidy2× diploid · measured
Chromosome records18–482n range24median24mode46records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 2444×GoaT · Kew Plant DNA C-values Database · CCDB · slov-fl · CCDB · iber-fl +16
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · slov-fl — Májovský J., Murín A., Feráková V., Hindáková M., Schwarzová T., Uhríková A., Váchová M. & Záborský J., 1987: Karyotaxonomický prehľad flóry Slovenska. Veda, Bratislava.
CCDB · iber-fl — Chromosomenzahlen aus der Tribus Cardueae (Compositae). Hellwig, H. Frank.Willdenowia24: 219-248(1994).
CCDB · iber-fl — Contribution la connaissance cytotaxinomique des spermatophyta du Portugal. II. Compositae Fernandes, A. & M. Queirs.Bol. Soc. Brot. ser. 245: 5-121(1971).
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=3872
CCDB · fl-europaea — Guinochet, 1957
CCDB · poland — Skali?ska M., Jankun A., Wcis?o H. et al. 1976. Further studies in chromosome numbers of Polish Angiosperms. Eleventh contribution. Acta Biol. Cracov. Ser. Bot. 19, 107-148.
CCDB · mediterranean
CCDB · ipcn-api-dl — Arohonka, T. 1982. Chromosome counts of vascular plants of the island Seili in Nauvo, southwestern Finland. Turun Yliopiston Julkaisuja, Sar. A 2, Biol.-Geogr. 3: 1–12.
CCDB · ipcn-api-dl — Dmitrieva, S. A. & V. I. Parfenov. 1983. Khromosomnye chisla nekotorykh vidov flory Belorussii. Izv. Akad. Nauk Belorussk. SSR, Ser. Biol. Nauk 2: 7–12.
CCDB · ipcn-api-dl — Wang, X. l. & M. x. Li. 1987. Observation of chromosomes on 10 composite species. J. Wuhan Bot. Res. 5: 111–117.
CCDB · ipcn-api-dl — Sekovski, Z. & M. Jovanovska. 1983. Chromosome atlas of some Macedonian angiosperms. IV. Ann. Fac. Biol. Univ. Skopje. 36: 73–86.
CCDB · ipcn-api-dl — Napoli, M. & A. Zizza. 1984. Números cromosomáticos de plantas occidentales, 270--279. Anales Jard. Bot. Madrid 40: 451–455.
CCDB · ipcn-api-dl — Strid, A. 1987. Chromosome numbers of Turkish mountain plants. Notes Roy. Bot. Gard. Edinburgh 44: 351–356.
CCDB · ipcn-api-dl — Georgiadis, T. & D. Christodoulakis. 1984. Contribution à l'étude cytogéographique des Centaurées de l'île de Samos. Candollea 39: 307–318.
CCDB · ipcn-api-dl — Krasnikov, A. A. 1991. Chromosome numbers in some species of vascular plants from Novosibirsk region. Bot. Žhurn. (Moscow & Leningrad) 76: 476–479.
CCDB · ipcn-api-dl — Huber, W. & M. Baltisberger. 1992. IOPB chromosome data 4. Int. Organ. Pl. Biosyst. Newslett. (Zurich) 18/19: 6–8.
CCDB · ipcn-api-dl — Hellwig, F. H. 1994. Chromosomenzahlen aus der Tribus Cardueae (Compositae). Willdenowia 24: 219–248.
CCDB · ipcn-api-dl — Sharkova, S. T. 1996. Mediterranean chromosome number reports 6 (767--772). Fl. Medit. 6: 328–333.
CCDB · ipcn-api-dl — Bancheva, S. T. 1998. Mediterranean chromosome number reports 8 (970--976). Fl. Medit. 8: 273–280.
CCDB · ipcn-api-dl — Albers, F. & W. Pröbsting. 1998. In R. Wisskirchen & H. Haeupler, Standardliste der Farn- und Blütenpflanzen Deutschlands. Bundesamt für Naturschutz & Verlag Eugen Ulmer, Stuttgart.
CCDB · ipcn-api-dl — Lövkvist, B. & U. M. Hultgård. 1999. Chromosome numbers in south Swedish vascular plants. Opera Bot. 137: 1–42.
CCDB · ipcn-api-dl — Ubera, J. L. 1980. In Numeros cromosomicos para la flora Esparlola. 121-182. Lagascalia 9: 249 –284.
CCDB · ipcn-api-dl — Devesa, J. A. 1979. In Numeros cromosomicos para la flora Espanola. 84-120. Lagascalia 9: 115–130.
CCDB · ipcn-api-dl — Skalinska, M., H. JANKUN, H. Wcislo & e. al. 1976. Further studies in chromosome numbers of Polish angiosperms. XI. Acta Biol. Cracov., Ser. Bot. 19: 107–148.
CCDB · ipcn-api-dl — Chen, R. y., W. q. Song, X. l. Li, M. x. Li, G. l. Liang & C. b. Chen. 2003. Chromosome Atlas of Major Economic Plants Genome in China, Vol. 3, Chromosome Atlas of Garden Flowering Plants in China. Science Press, Beijing.
CCDB · ipcn-api-dl — Bancheva, S. & J. Greilhuber. 2006. Genome size in Bulgarian Centaurea s.l. (Asteraceae). Pl. Syst. Evol. 257: 95–117.
CCDB · book-ipcn67-71 — TONJAN, Z.R. 1968. The chromosome numbers of some species of the genus Centaurea. (In Russian) Biol. Zurn. Arm. S.S.R. 21: 86-96.
CCDB · book-ipcn67-71 — GUINOCHET, M. 1957. Contribution a l'etude caryologique du genre Centaurea L. sens. lat. soc. Hist. Nat. Afrique Nord 48: 282-300.
CCDB · book-ipcn67-71 — FERNANDES, A., & M. QUEIROS. 1971. Contribution a la connaissance cytotaxinomique des Spermatophyta du Portugal. II Compositae Bol. soc. Brot. 45 (ser. 2l: 5-122.
CCDB · book-ipcn67-71 — Q13 SPETA, F. 1971. Chromosomenzahlen einiger Angiospermen. Oesterr. Bot. z. 119: 1-5.
CCDB · book-northern-plants — l'ritsch 1935.
CCDB · book-ipcn73-74 — FRITSCH, R.M. 1973. In IOPB chromosome number reports XLI. Taxon 459-464.
CCDB · book-ipcn73-74 — POWELL, A.M., D.W. KYHOS, & P.H. RAVEN. 1974. Chromosome numbers in Compositae. X. Amer. J. Bot. 61: 909-913.
CCDB · book-indian_vol1 — Poddubnaja-Arnoldi, V. 1931 (Fedo- rov); Morinaga, T. et al. 1929; Tischler, G. 1934, 1937 ; Fritsch, R. 1935 ; Rohweder, H. 1937; Love, A. & Love, D. 1956b ; Guinochet, M. 1957 ; Mehra, P.N. et al. 1965 ; Tonjan, Z.R. 1968b; Fernandes, A. & Queiros, M. 1971 ; Speta, F. 1971a ; Gupta, P.K. et al. 1972 ; Fritsch, R.M. 1973 ; Powell, A.M. et al. 1974
CCDB · eflora
CCDB · book-fedorov — LOve A., LOve D. 1961b
CCDB · book-atlas-flowering-plants — Fritsch 1935
CCDB · kew — Bancheva S, Greilhuber J. 2006. Genome size in Bulgarian Centaurea s.l. (Asteraceae). Plant Systematics and Evolution 257: 95-117.
CCDB · kew — Garcia S, Hidalgo O, Jakovljević I, Siljak-Yakovlev S, Vigo J, Garnatje T, Vallès J. 2013. New data on genome size in 128 Asteraceae species and subspecies, with first assessments for 40 genera, 3 tribes and 2 subfamilies. Plant Biosystems 147: 1219-1227.
+3 more references
2n 181×CCDB · iber-fl
CCDB · iber-fl — Estudios citogenticos en especies espaolas del gnero Centaurea. Granada. Fernndez Morales, M. J.*(1974).
2n 481×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Yang, D. k. 2001. The karyotype studies of Centaurea cyanus and Coreopsis grandiflora. J. Shandong Norm. Univ., Nat. Sci. Ed. 16(1): 75–78.
n 126×CCDB · iber-fl · CCDB · book-ipcn65 · CCDB · ipcn-api-dl
CCDB · iber-fl — Nmeros cromosmicos para la flora espaola, 110-115. Devesa, J. A.Lagascalia9(1): 126-128(1979).
CCDB · iber-fl — Nmeros cromosmicos para la flora espaola, 132-136. Ubera, J. L.Lagascalia9(2): 257-259(1980).
CCDB · book-ipcn65 — Mehra et al. 1965
CCDB · ipcn-api-dl — Gupta, R. C. & B. S. Gill. 1989. Cytopalynology of north and central Indian Compositae. J. Cytol. Genet. 24: 96–105.
CCDB · ipcn-api-dl — Razaq, Z. A., A. A. Vahidy & S. I. Ali. 1994. Chromosome numbers in Compositae from Pakistan. Ann. Missouri Bot. Gard. 81: 800–808.
CCDB · ipcn-api-dl — Devesa, J. A. 1979. In Numeros cromosomicos para la flora Espanola. 84-120. Lagascalia 9: 115–130.
n 91×CCDB · iber-fl
CCDB · iber-fl — Estudios citogenticos en especies espaolas del gnero Centaurea. Granada. Fernndez Morales, M. J.*(1974).
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
07Deep time~8.04 Ma lineage
How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.
At a glance
DNA clock origin8.04 Ma TimeTree
When this lineage existed
How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.
DNA clock origin
How it livedPBDB
Dietphotoautotroph
08Occurrence & distribution
Record type147 456 records
Wild obs. + sensor138 291
Museum / vouchered8 623
Cultivated / captive25
Other517
Origin
Native102
Introduced2 656
Range
Area of Occupancy AOO257 152 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy50% within 1 km
≤100 m 34 859≤1 km 23 633≤10 km 56 499>10 km 1 581
116 572 georeferenced · 21 719 without coordinates
Open the mapobservation + sensor138 291
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy32% within 1 km
≤100 m 271≤1 km 1 160≤10 km 2 791>10 km 208
4 430 georeferenced · 4 193 without coordinates
Open the institutions mapphysical evidence8 623
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
≤10 km 5>10 km 16
21 georeferenced · 4 without coordinates
Open the mapnot free-living25
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions202 of 330 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 1 298 |
| BFLlocation not on record | 326 |
| LDlocation not on record | 325 |
| Kuopio, FI | 325 |
| Paris, FR | 251 |
| Moscow State Universitylocation not on record | 250 |
| Berlin, DE | 245 |
| BIO-UNIPIlocation not on record | 221 |
| BRNUlocation not on record | 193 |
| Oskarshamn, SE | 174 |
| Oulu, FI | 146 |
| MeiseBGlocation not on record | 132 |
| South Kensington, GB | 132 |
| Jyväskylä, FI | 123 |
| Uniwersytet Warszawskilocation not on record | 122 |
| Turku, FI | 113 |
| IFR-DNFlocation not on record | 98 |
| SLU Artdatabankenlocation not on record | 88 |
| BDBClocation not on record | 88 |
| Tartu, EE | 75 |
| Adam Mickiewicz University in Poznańlocation not on record | 71 |
| Pullman, US | 71 |
| Philadelphia, US | 59 |
| Entomological Society of Latvialocation not on record | 55 |
| TUR-Alocation not on record | 54 |
| València, ES | 50 |
| Corvallis, US | 49 |
| MAlocation not on record | 49 |
| WTUlocation not on record | 48 |
| Zürich, CH | 45 |
| Barcelona, ES | 43 |
| Provincia di Livornolocation not on record | 43 |
| Görlitz, DE | 41 |
| Zürich, CH | 37 |
| Wuzhou, CN | 37 |
| Bronx, US | 36 |
| Uppsala, SE | 35 |
| Porvoo, FI | 33 |
| Bern, CH | 32 |
| UGentlocation not on record | 32 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 29 |
| College Park, US | 29 |
| Tallinn, EE | 28 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 27 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 26 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 24 |
| Vitoria, ES | 23 |
| Bangkok, TH | 23 |
| Fort Worth, US | 22 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 21 |
| Salamanca, ES | 21 |
| Burlington, US | 20 |
| Williamsburg, US | 20 |
| Vancouver, CA | 20 |
| Riverside, US | 18 |
| Tula State Universitylocation not on record | 18 |
| CJBGlocation not on record | 18 |
| Beijing, CN | 18 |
| Cheney, US | 18 |
| Uniwersytet Opolskilocation not on record | 17 |
| Chongqing Museumlocation not on record | 17 |
| UniKSlocation not on record | 17 |
| Frankfurt am Main | 16 |
| Saint Louis, US | 16 |
| Canadian Department of Agriculturelocation not on record | 15 |
| Arcata, US | 15 |
| University of Stellenboschlocation not on record | 14 |
| Santa Barbara, US | 14 |
| Christchurch, NZ | 14 |
| WNNUlocation not on record | 13 |
| College of the Atlantic, Museumlocation not on record | 13 |
| Wlocation not on record | 13 |
| Madrid, ES | 13 |
| Claremont, US | 13 |
| BSBIlocation not on record | 13 |
| Nagano City, JP | 12 |
| Emporia, US | 12 |
| CICYTEXlocation not on record | 12 |
| QAUlocation not on record | 12 |
| Garðabær, IS | 12 |
| DBF-NHMDlocation not on record | 12 |
| Université Lavallocation not on record | 12 |
| Natural History Museum Rotterdamlocation not on record | 11 |
| Davis, US | 11 |
| Mlocation not on record | 11 |
| Dekalb, US | 11 |
| Stockholm, SE | 11 |
| Fulda, DE | 10 |
| Palacký University in Olomouclocation not on record | 10 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 10 |
| Québec, CA | 10 |
| Allentown, US | 10 |
| CASlocation not on record | 10 |
| San Sebastián, ES | 10 |
| Flagstaff, US | 10 |
| Knoxville, US | 10 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 9 |
| PRClocation not on record | 9 |
| The Tula Region State Institution of Culture "Tula Museum Association"location not on record | 9 |
| IDElocation not on record | 9 |
| Frauenfeld, CH | 9 |
| Philadelphia, US | 9 |
| Portland, US | 8 |
| Auckland, NZ | 8 |
| Bloomington, US | 8 |
| Tilburg, NL | 8 |
| Montréal, CA | 8 |
| Rovaniemi, FI | 8 |
| Chapel Hill, US | 8 |
| Fayetteville, US | 8 |
| Chadron, US | 8 |
| GZUlocation not on record | 7 |
| Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record | 7 |
| Brussel, BE | 7 |
| Hobart, AU | 7 |
| San Luis Obispo, US | 7 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 7 |
| Xinxiang, CN | 7 |
| Norfolk, US | 7 |
| Tuscaloosa, US | 7 |
| Denver, US | 7 |
| Staten Island, US | 6 |
| Moscow, US | 6 |
| University of Birminghamlocation not on record | 6 |
| Spearfish, US | 6 |
| Alicante, ES | 6 |
| Canberra, AU | 6 |
| Victoria, CA | 6 |
| Boise, US | 6 |
| Missoula, US | 5 |
| ASUlocation not on record | 5 |
| Angwin, US | 5 |
| Kew, GB | 5 |
| Karlsruhe, DE | 5 |
| University of New Hampshirelocation not on record | 5 |
| St. Paul, US | 5 |
| Badajoz, ES | 5 |
| Tampa, US | 5 |
| The State Museum-Preserve "The Kulikovo pole"location not on record | 5 |
| Columbia, US | 5 |
| Logan, US | 5 |
| Clemson, US | 5 |
| Pamplona, ES | 5 |
| Madison, US | 5 |
| Western Carolina Universitylocation not on record | 5 |
| Denton, US | 5 |
| DOI/NPS, Greenbelt Parklocation not on record | 4 |
| Bourges, FR | 4 |
| Universidad de La Salle (La Salle)location not on record | 4 |
| Santa Cruz, US | 4 |
| University of Alberta Museumslocation not on record | 4 |
| Museo Achille Folettolocation not on record | 4 |
| Davenport, US | 4 |
| Tromso University Museumlocation not on record | 4 |
| Ann Arbor, US | 4 |
| Acadia Universitylocation not on record | 4 |
| San Diego, US | 4 |
| Podgorica, ME | 4 |
| Yangling, CN | 4 |
| GJOlocation not on record | 4 |
| Dresden, DE | 4 |
| Taipei, TW | 4 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 4 |
| US | 4 |
| Provo, US | 4 |
| University of North Carolina at Pembrokelocation not on record | 4 |
| EL PASO, US | 4 |
| Bend, US | 4 |
| GAlocation not on record | 4 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 3 |
| Walla Walla, US | 3 |
| Forssa, FI | 3 |
| Changsha, CN | 3 |
| Bozeman, US | 3 |
| Córdoba, AR | 3 |
| Pamplona, ES | 3 |
| Saint John, CA | 3 |
| Finnish Museum of Natural History, Botanical Museumlocation not on record | 3 |
| Uniwersytet Śląski w Katowicachlocation not on record | 3 |
| Johnson City, US | 3 |
| Philadelphia, US | 3 |
| Mexico City, MX | 3 |
| Guangzhou, CN | 3 |
| H-Schuhwlocation not on record | 3 |
| Wellington, NZ | 3 |
| Glarus, CH | 3 |
| Kunming, CN | 3 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 3 |
| Naturalis Biodiversity Centerlocation not on record | 3 |
| Winterthur, CH | 3 |
| Monastir, TN | 3 |
| Sede di Via Giorgio La Pira del Museo di Storia naturale di Firenze | Via Giorgio La Pira headquarter of the Natural History Museum in Florencelocation not on record | 3 |
| Wuhan, CN | 3 |
| Austin, US | 3 |
| Jena Microbial Resource Collectionlocation not on record | 3 |
| Urumqi, CN | 3 |
| Porrentruy, CH | 3 |
| Mississippi State, US | 3 |
| New Haven, US | 3 |
| Ashland, US | 3 |
| Chiba, JP | 3 |
| Caldwell, US | 3 |
| DOI/NPS, Selma to Montgomery National Historic Traillocation not on record | 2 |
| Toronto, CA | 2 |
| Granada, ES | 2 |
| University of Hamburglocation not on record | 2 |
| Long Beach, US | 2 |
| Sevilla, ES | 2 |
| Henderson State Universitylocation not on record | 2 |
| San Isidro, AR | 2 |
| BISHlocation not on record | 2 |
| Museo della Bonifica di San Donà di Piavelocation not on record | 2 |
| AUAlocation not on record | 2 |
| BGBMlocation not on record | 2 |
| KNFHClocation not on record | 2 |
| Bando, JP | 2 |
| Zhengzhou, CN | 2 |
| Tomioka, JP | 2 |
| Los Angeles, US | 2 |
| Pocatello, US | 2 |
| Kawasaki Shi Tama Ku, JP | 2 |
| BG-NMNHSlocation not on record | 2 |
| Firenze, IT | 2 |
| Millersville, US | 2 |
| Little Rock, US | 2 |
| Nijmegen, NL | 2 |
| Otaru, JP | 2 |
| Namur, BE | 2 |
| SZUlocation not on record | 2 |
| Museo Entomologico de Leonlocation not on record | 2 |
| Lubbock, US | 2 |
| Parkville, AU | 2 |
| Laboratory of Palaeontologylocation not on record | 2 |
| STNFlocation not on record | 2 |
| KURAlocation not on record | 2 |
| Northridge, US | 2 |
| ISAlocation not on record | 2 |
| Washington, US | 2 |
| Research Collection of B. A. Bennettlocation not on record | 2 |
| Lincoln, US | 2 |
| Universidad de Caldas (UCaldas)location not on record | 2 |
| NMBU:MINAlocation not on record | 2 |
| Osaka, JP | 2 |
| Odawara, JP | 2 |
| San Francisco, US | 2 |
| Conway, US | 2 |
| Sion, CH | 2 |
| Phoenix, US | 2 |
| Pretoria, ZA | 2 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 2 |
| Weymouth Woods Sandhills Nature Preservelocation not on record | 2 |
| Ural Federal University "B. N. Yeltsin"location not on record | 1 |
| Smithfield, AU | 1 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 1 |
| Umeå Universitylocation not on record | 1 |
| Moscow University Herbarium (MW)location not on record | 1 |
| H-Dunkellocation not on record | 1 |
| KNFYlocation not on record | 1 |
| DOI/NPS, Mississippi National River & Recreation Arealocation not on record | 1 |
| Hazara Universitylocation not on record | 1 |
| GB | 1 |
| Audubon Society -- Silver Bluff Audubon Center and Sanctuarylocation not on record | 1 |
| Göteborg, SE | 1 |
| Severin-McDaniel Insect Collectionlocation not on record | 1 |
| Istituto Agrario Castelnuovolocation not on record | 1 |
| BClocation not on record | 1 |
| UoB-IBlocation not on record | 1 |
| Royal Botanic Garden Edinburghlocation not on record | 1 |
| Nanjing, CN | 1 |
| Nanjing, CN | 1 |
| Pacific Lutheran Universitylocation not on record | 1 |
| IPE-CSIClocation not on record | 1 |
| Kushiro City Museumlocation not on record | 1 |
| UIBlocation not on record | 1 |
| TAIElocation not on record | 1 |
| St. Augustine, TT | 1 |
| Anchorage, US | 1 |
| Masindi, UG | 1 |
| Uberlândia, BR | 1 |
| Durban, ZA | 1 |
| Valparaiso, CL | 1 |
| DOI/FWS, Kenai National Wildlife Refugelocation not on record | 1 |
| Banyoles, ES | 1 |
| Taipei, TW | 1 |
| Tuxtla Gutiérrez, MX | 1 |
| Fairfax, US | 1 |
| Nagatoro-machi, Chichibu-gun, JP | 1 |
| ROM020location not on record | 1 |
| DMZ botanic gardenlocation not on record | 1 |
| Central Botanical Gardenlocation not on record | 1 |
| San Jose, US | 1 |
| Córdoba, ES | 1 |
| Baltimore, US | 1 |
| China Agricultural Universitylocation not on record | 1 |
| Cambridge University Herbariumlocation not on record | 1 |
| Nishihara, JP | 1 |
| WINlocation not on record | 1 |
| Honolulu, US | 1 |
| Jaén, ES | 1 |
| Durango, MX | 1 |
| Lausanne, CH | 1 |
| Conway, US | 1 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 1 |
| Whitehorse, CA | 1 |
| Awka, NG | 1 |
| Ivano-Frankove, UA | 1 |
| West Virginia Wesleyan Collegelocation not on record | 1 |
| KNFSClocation not on record | 1 |
| Samara National Research Universitylocation not on record | 1 |
| Due West, US | 1 |
| Wuhan, CN | 1 |
| Fredericksburg, US | 1 |
| US | 1 |
| Sagamihara, JP | 1 |
| National Museum Waleslocation not on record | 1 |
| Tsukuba, JP | 1 |
| Prioksko-Terrasnyi Biosphere Reservelocation not on record | 1 |
| Tacoma, US | 1 |
| Portland, US | 1 |
| Nishihara, JP | 1 |
| McManus: Dundee's Art Gallery & Museumlocation not on record | 1 |
| Harrisonburg, US | 1 |
| Xiamen, CN | 1 |
| KOMlocation not on record | 1 |
| Mount Annan, AU | 1 |
| Jinghong, CN | 1 |
| Turlock, US | 1 |
| Kingston, US | 1 |
| Albuquerque, US | 1 |
| POL003location not on record | 1 |
330 institutions · 7 227 of 8 623 vouchered records shown · 869 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA26 detections
Where the DNA of Centaurea cyanus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found26
Studies independent surveys2
Countries7
Signal confidence: moderateweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 26 detections have coordinates
Open the map7 countries0
Open dry roadside with Lathyrus sylvestris.Escape from flowerbed.on disturbed ground
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median12.9 °C 6.70–18.1
Seasonal swing summer↔winter20.1 °C
Max temp (day)15.4 °C 9.30–22.5
Min temp (night)8.90 °C 3.60–13.9
Precipitation82.3 mm/mo 49.7–123
Air humidity62.6 % 58.5–67.0
Moisture balance-19.9 mm/mo -50.7–59.3
Vapour deficit552 Pa 350–845
Wind speed3.50 m/s 2.20–4.80
Cloud cover44.4 % 36.4–63.7
CHELSA 1981–2010, ~9 km grid, at location & month of 17 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.