Centaurea cyanoides

Berggr. & Wahlenb. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Centaurea

At a glance

Occurrence records871

Data sources6

Biological traits8

DNA specimens2

eDNA detections2

Sources6 archives

Databases and archives Centaurea cyanoides's data was compiled from.

GBIFGlobal Biodiversity Information Facility871 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements2 literature sources8 traits

Occurrence & distributionGBIF871 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

02Traits & measurements

SourcesWCVPGIFT

Life cycle & reproduction2

Life spanannual

Raunkiær life formtherophyte

Diet & foraging1

Parasiteindependent

Habitat & environment5

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Growth formherb

Woodinessnon-woody

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Centaurea cyanoides has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes2

GenBank sequences5

eDNA detections2

Countries2

The DNA barcodea real sequence read deposited for this species

ITSHQ147616.1 ↗212 bpLebanon

ACGT

TCGCGTCGCCCAGACCATGCTCCCCCATGGGGACGTGTTTGGTCTGGGACGGAGACTGGTCTCCCGTGCCGATGGTGCGGTTGGCCTAAA …

Centaurea cyanoides voucher Maitland 391 (LE) internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS5★ITS2

fungal barcode

08Occurrence & distribution

Record type871 records

Wild obs. + sensor860

Museum / vouchered11

Range

Area of Occupancy AOO1 104 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy77% within 1 km

≤100 m 100≤1 km 37≤10 km 41>10 km 1

179 georeferenced · 681 without coordinates

Open the mapobservation + sensor860

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 11 records without

Open the institutions mapphysical evidence11

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Rishon Le Zion, IL	3
LDlocation not on record	3
Paris, FR	2
South Kensington, GB	2

4 institutions · 10 of 11 vouchered records shown

09Environmental DNA2 detections

Where the DNA of Centaurea cyanoides was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.0 °C 10.0–10.0

Seasonal swing summer↔winter19.1 °C

Max temp (day)15.2 °C

Min temp (night)3.90 °C

Precipitation73.0 mm/mo

Air humidity53.1 %

Moisture balance-41.1 mm/mo

Vapour deficit672 Pa

Wind speed3.20 m/s

Cloud cover29.8 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)