Centaurea cineraria

species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Centaurea

At a glance

Occurrence records665

Data sources12

Biological traits25

DNA specimens3

eDNA detections1

Sources12 archives

Databases and archives Centaurea cineraria's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility665 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

Paleobiology DatabasePBDB consortiumfossil record↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources25 traits

Chemical compositionLOTUS · NPASS32 compounds

Occurrence & distributionGBIF665 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB2n = 18

01Narrative

Centaurea cineraria, la Centaurée cendrée ou Centaurée cinéraire, est une espèce de plante à fleurs de la famille des Astéracées. C'est une plante herbacée méditerranéenne.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTAusTraitsTRY

Size & morphology12

Fruit length4.3 mm

⚠ sources differ — AusTraits: 4.3 mm · GIFT: 5 mm

Leaf length100 mm

Leaf length max140 mm

Leaf width45 mm

Leaf width max45 mm

Leaf width min45 mm

Plant height0.6 m

⚠ sources differ — GIFT: 0.6 m · AusTraits: 0.9 m

Plant height max0.75 m

Seed length4 mm

Seed length max4 mm

Seed length min4 mm

Seed mass2.61 mg

Life cycle & reproduction3

Dispersal typewind

Life formperennial or subshrub

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit typeachene

Growth formherb

Leaf shapeelliptical

Woodinessnon-woody

Physiology & chemistry1

Photosynthetic pathwayC3

03Chemical composition32 compounds

Compounds documented for Centaurea cineraria across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Fatty aldehydes7

Flavones6

Unsaturated fatty acids3

Germacrane sesquiterpenoids3

Oleanane triterpenoids3

Documented compounds32 total

Tissue Source Quantified only

Compound	Amount	Source
(-)-Arctigenin	present	LOTUS
(1S,2R,4aR,6aR,6aR,6bR,8aR,10S,12aR,14bR)-10-hydroxy-1,2,4a,6b,9,9,12a-heptamethyl-2,3,4,5,6,6a,7,8,8a,10,11,12,13,14b-tetradecahydro-1H-picene-6a-carboxylic acid	present	NPASS
(3aS,4R,6R,7S,7aS)-6-ethenyl-4-hydroxy-7-(3-hydroxyprop-1-en-2-yl)-6-methyl-3-methylidene-4,5,7,7a-tetrahydro-3aH-1-benzofuran-2-one	present	LOTUS
(4aR,6aR,6aR,6bR,8aR,10R,12aR,14bR)-10-acetyloxy-2,2,4a,6b,9,9,12a-heptamethyl-1,3,4,5,6,6a,7,8,8a,10,11,12,13,14b-tetradecahydropicene-6a-carboxylic acid	present	NPASS
(5E,7E,11E,13E)-pentadeca-5,7,11,13-tetraen-9-ynal	present	LOTUS
(6E,8E,12E,14E)-hexadeca-6,8,12,14-tetraen-10-ynal	present	LOTUS
(7E,9E,11E,13E)-hexadeca-7,9,11,13-tetraenal	present	LOTUS
(7E,9E,13E,15E)-heptadeca-7,9,13,15-tetraen-11-ynal	present	LOTUS
(8E,10E,14E,16E)-octadeca-8,10,14,16-tetraen-12-ynal	present	LOTUS
(9E,11E,13E,15E)-octadeca-9,11,13,15-tetraenal	present	LOTUS

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Centaurea cineraria has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes4

GenBank sequences10

eDNA detections1

Countries2

The DNA barcodea real sequence read deposited for this species

ITSKF032410.1 ↗594 bpItaly · 2008

ACGT

CGACCCGTGAACATGTAATCACAACCGGGTGTCTGGGGGTCGGGTGCGAGCCTTAGCCCTGCGATGCTCGCCGGCATGCGTTCAAGGTGG …

Centaurea cineraria isolate A voucher V-1104 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★ITS8★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Centaurea cineraria carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidydiploid inferred

Chromosome records18–362n range18median18mode25records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 1823×CCDB · ita-fl · CCDB · fl-europaea · CCDB · ipcn-api-dl +6

CCDB · ita-fl — GORI C. - 1954. Osservazioni sul cariogramma e sul ciclo nucleolare di "Centaurea cineraria" L.. Caryologia , 6(2-3): 241-246.

CCDB · ita-fl — DAMBOLDT J., MATTHAES U. - 1975. Chromosomenzahlen einiger mediterraner und mitteleuropaeischer Centaurea-Arten (Asteraceae).. Pl. Syst. Evol. , 123: 107-115.

CCDB · ita-fl — LARSEN K. - 1956. Chromosome studies in some Mediterranean and South European flowering plants.. Bot. Not. , 109(3): 293-307.

CCDB · ita-fl — SPETA F. - 1971. Chromosomenzahlen einiger Angiosperm.. Oesterr. Bot. Z. , 119(1-3): 1/5/2000.

CCDB · ita-fl — VIEGI L., CELA RENZONI G., CORSI G., GARBARI F. - 1972. Numeri cromosomici per la flora italiana:135-144.. Inform. Bot. Ital. , 4(3): 229-236.

CCDB · ita-fl — CELA RENZONI G., VIEGI L. - 1982. Centaurea cineraria s.l. (Asteraceae) in Italia. Revisione tassonomica.. Atti Soc. Tosc. Sci. Nat. Pisa. Mem., ser. B , 89: 99-144.

CCDB · ita-fl — VIEGI L., CELA RENZONI G. - 1976. Numeri cromosomici per la flora italiana:276-282.. Inform. Bot. Ital. , 8(3): 276-281.

CCDB · ita-fl — VIEGI L., CELA RENZONI G. - 1991 (1990). Numeri cromosomici per la flora italiana: 1244-1246.. Inform. Bot. Ital. , 22(3): 240-243.

CCDB · fl-europaea — Gori, 1954

CCDB · fl-europaea — Viegi et al., 1972

CCDB · ipcn-api-dl — Viegi, L. & G. C. Renzoni. 1990. Numeri cromosomici per la flora Italiana: 1244--1246. Inform. Bot. Ital. 22: 240–243.

CCDB · book-ipcn72 — VIEGI, L., G.C. RENZONI, G. CORSI, & F. GARBARI. 1972. In Numeri cromosomici per la flora Italiana. Informatore Bot. Ital. 4: 224-236.

CCDB · book-ipcn67-71 — Q13 SPETA, F. 1971. Chromosomenzahlen einiger Angiospermen. Oesterr. Bot. z. 119: 1-5.

CCDB · book-ipcn75-78 — Viegi & Renzoni 1976

CCDB · book-ipcn73-74 — POWELL, A.M., D.W. KYHOS, & P.H. RAVEN. 1974. Chromosome numbers in Compositae. X. Amer. J. Bot. 61: 909-913.

CCDB · Cave1956 — Larsen a

CCDB · Cave1962 — Guinochet & F. 1962

2n 362×CCDB · ita-fl · CCDB · ipcn-api-dl

CCDB · ita-fl — DAMBOLDT J., MATTHAES U. - 1975. Chromosomenzahlen einiger mediterraner und mitteleuropaeischer Centaurea-Arten (Asteraceae).. Pl. Syst. Evol. , 123: 107-115.

CCDB · ipcn-api-dl — Damboldt, J. & U. MATTHAS. 1975. Chromosomenzahlen eininger mediterraner und mitteleuropaischer Centaurea-Arten (Asteraceae). Pl. Syst. Evol. 123: 107–115.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type665 records

Wild obs. + sensor578

Museum / vouchered87

Origin

Introduced10

Range

Area of Occupancy AOO1 784 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy97% within 1 km

≤100 m 403≤1 km 34≤10 km 11>10 km 1

449 georeferenced · 129 without coordinates

Open the mapobservation + sensor578

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy61% within 1 km

≤100 m 5≤1 km 29≤10 km 22

56 georeferenced · 31 without coordinates

Open the institutions mapphysical evidence87

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions18 of 31 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
BIO-UNIPIlocation not on record	8
Canadian Department of Agriculturelocation not on record	8
Adelaide, AU	7
Claremont, US	6
CJBGlocation not on record	5
Canberra, AU	4
Sede di Via Giorgio La Pira del Museo di Storia naturale di Firenze \| Via Giorgio La Pira headquarter of the Natural History Museum in Florencelocation not on record	4
San Diego, US	3
Museo Entomologico de Leonlocation not on record	3
Catalina Island Conservancylocation not on record	2
LDlocation not on record	2
Barcelona, ES	2
Davis, US	2
Santa Barbara, US	2
Christchurch, NZ	2
College of the Atlantic, Museumlocation not on record	2
Riverside, US	2
IDElocation not on record	2
Armidale, AU	1
JBSlocation not on record	1
La Paz, BO	1
Oskarshamn, SE	1
Hobart, AU	1
Auckland, NZ	1
Mount Annan, AU	1
Irvine, US	1
University of Stellenboschlocation not on record	1
Saint Louis, US	1
Institut und Museum fuer Geologie und Palaeontologielocation not on record	1
Turlock, US	1
Severin-McDaniel Insect Collectionlocation not on record	1

31 institutions · 79 of 87 vouchered records shown · 7 without an institution code

09Environmental DNA1 detections

Where the DNA of Centaurea cineraria was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.5 °C 12.5–12.5

Seasonal swing summer↔winter27.0 °C

Max temp (day)18.4 °C

Min temp (night)8.20 °C

Precipitation79.6 mm/mo

Air humidity57.3 %

Moisture balance-38.4 mm/mo

Vapour deficit733 Pa

Wind speed5.80 m/s

Cloud cover36.7 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)