Centaurea calcitrapa
speciesAt a glance
Occurrence records23 273
Data sources13
Biological traits63
DNA specimens52
eDNA detections19
Sources13 archives
Databases and archives Centaurea calcitrapa's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility23 273 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI19 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics52 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources63 traits
Chemical compositionLOTUS · NPASS72 compounds
Occurrence & distributionGBIF23 273 records
Environmental DNA1 datasets · 6 countries19 detections
DNA & barcodingBOLD · NCBI52 specimens
Genome at a glanceCCDB · GoaT905 Mbp
01Narrative
La Centaurée Chausse-trape, Centaurée étoilée ou Chardon étoilé, est une espèce de plantes à fleurs de la famille des Asteraceae (Composées).
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTAusTraitsLEDATRYWCVP
Size & morphology17
Fruit length3 mm
Fruit length max3 mm
Fruit length min2.5 mm
Leaf length80 mm
Leaf length max250 mm
Leaf mass73.14 mg
Leaf size1 669 mm²
Leaf width10 mm
Leaf width max90 mm
Leaf width min10 mm
Plant height0.425 m
⚠ sources differ — GIFT: 0.425 m · AusTraits: 1 m · LEDA: 0.35 m · TRY: 0.433 m
Plant height generative0.381 m
Plant height max1 m
Plant height min0.1 m
Seed mass2.3 mg
Seed mass max2.3 mg
Seed mass min2.3 mg
Life cycle & reproduction19
Deciduousnessaestival
⚠ sources differ — TRY: aestival · GIFT: deciduous
Dehiscenceindehiscent
Dispersal typeanimal
⚠ sources differ — LEDA: epizoochor · GIFT: unspecialized
Flower colourpurple
Flower length max20 mm
Flower length min15 mm
Flowering endSep
Flowering startApr
Flowering timeyynnnnnnyyyy
Life formbiennial
Life spanstrict monocarpic bi-annuals and poly-annuals
⚠ sources differ — TRY: strict monocarpic bi-annuals and poly-annuals · AusTraits: annual biennial · LEDA: strict monocarpic bi-annuals and poly-annuals · GIFT: biennial
Lifespan years1.5 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formhemicryptophyte
⚠ sources differ — LEDA: Hemicryptophyte · GIFT: therophyte
Reproduction asexualabsent
Resprouting capacityfire_killed
Seed number5 530
Self fertilizationpresent
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment15
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max1 800 m
Elevation min0 m
Epiphyteterrestrial
Fruit colourbrown
Fruit typeachene
Growth formherb
Habitat GIFTLowland
Leaf compoundnesssimple
Leaf formlinear
Leaf shapelanceolate linear narrowly_lanceolate oblanceolate
Mycorrhizaabsent
Woodinessnon-woody
Physiology & chemistry5
Leaf dry-matter content (LDMC)166 mg/g
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
Seed longevity index0.5
Specific leaf area (SLA)17.88 mm²/mg
⚠ sources differ — TRY: 17.88 mm²/mg · LEDA: 22.82 mm²/mg · GIFT: 22.82 mm²/mg
Other traits5
Defenseyes
Diaspore typefruit
Monocarpymonocarp
Plant support typefree-standing
Shoot orientationerect
03Chemical composition72 compounds
Compounds documented for Centaurea calcitrapa across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Flavonols17
N-acyl amines8
Quinoline alkaloids4
Germacrane sesquiterpenoids4
Menthane monoterpenoids $ Monocyclic monoterpenoids3
Documented compounds72 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (+)-Linalyl acetate | present | NPASS | |
| (+)-Pinoresinol | present | LOTUS | |
| (-)-Arctigenin | present | LOTUS | |
| (-)-Matairesinol | present | LOTUS | |
| (1S,3R,4R,5R)-3-(3-(3,4-Dihydroxyphenyl)Prop-2-Enoyloxy)-1,4,5-Trihydroxycyclohexane-1-Carboxylic Acid | present | NPASS | |
| (2e,6e,8e)-N-(2-hydroxy-2-methylpropyl)-10-oxo-2,6,8-decatrienamide | present | NPASS | |
| (2E,6R,7E,9E)-6-hydroxy-N-(2-hydroxy-2-methylpropyl)-11-oxododeca-2,7,9-trienamide | present | NPASS | |
| (2E,6Z,8E,10Z)-N-(2-hydroxy-2-methylpropyl)dodeca-2,6,8,10-tetraenamide | present | NPASS | |
| (2e,7e,9e)-N-(2-hydroxy-2-methylpropyl)-6,11-dioxo-2,7,9-dodecatrienamide | present | NPASS | |
| (2S)-2,6-dimethyl-2-(4-methylpent-3-enyl)pyrano[3,2-c]quinolin-5-one | present | NPASS |
05DNA & barcoding52 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Centaurea calcitrapa has left across the world's sequence archives.
At a glance
DNA specimens52
Marker genes7
GenBank sequences10
eDNA detections19
Countries8
The DNA barcodea real sequence read deposited for this species
GTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATTCGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCA …
Centaurea calcitrapa subsp. calcitrapa voucher PLT.0363 5.8S ribosomal RNA gene and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK3★rbcL4★rbcLa★trnL-F★ITS3★ITS2trnH-psbA
plant barcodefungal barcodemarker
06Genome at a glanceCCDB · GoaT
The complete instruction manual Centaurea calcitrapa carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size904 650 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Centaurea calcitrapa0.90 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 20 n = 10
Ploidydiploid inferred
Chromosome records20–202n range20median20mode48records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 2048×GoaT · DTOL Flowering Plants Estimates Kew · GoaT · Kew Plant DNA C-values Database · CCDB · ita-fl +12
GoaT · DTOL Flowering Plants Estimates Kew
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · ita-fl — VIGNOLI L. - 1945. I cromosomi di "Centaurea calcitrapa" L. e "Centaurea macroacantha" Guss.. N. Giorn. Bot. Ital. , 52(1): 1/11/2014.
CCDB · ita-fl — GARDOU C. - 1972. Recherches biosystmatiques sur la section Jacea Cass. et quelques sections voisines du genre Centaurea L. en France et dans les rgions limitrophes.. Feddes Repert. , 83(5-6): 311-472.
CCDB · ita-fl — COLOMBO P., MARCEN C. - 1984. Etude cytotaxinomique de "Centaurea macroacantha" Guss. et son affinit avec "Centaurea calcitrapa" L.. Webbia , 38: 665-669.
CCDB · ita-fl — VILLA R. - 1980. Numeri cromosomici per la flora italiana:733-741.. Inform. Bot. Ital. , 12(2): 155-160.
CCDB · iber-fl — Chromosomenzahlen aus der Tribus Cardueae (Compositae). Hellwig, H. Frank.Willdenowia24: 219-248(1994).
CCDB · iber-fl — Contribution la connaissance cytotaxinomique des spermatophyta du Portugal. II. Compositae Fernandes, A. & M. Queirs.Bol. Soc. Brot. ser. 245: 5-121(1971).
CCDB · iber-fl — Cytotaxonomy of spanish plants. IV.-Dicotyledons: Caesalpinacea-Asteracea. Lve, A. & E. Kjellqvist.Lagascalia4(2): 153-211(1974).
CCDB · iber-fl — Estudios citogenticos en especies espaolas del gnero Centaurea. Granada. Fernndez Morales, M. J.*(1974).
CCDB · iber-fl — IOPB. Chromosome number reports. XLVI. Fernndez Morales, M. J.Taxon23(5/6): 805(1974).
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=3873
CCDB · fl-europaea — Fernandes & Queiros,
CCDB · ipcn-api-dl — Kuzmanov, B. A., S. B. Georgieva & V. A. Nikolova. 1986. Chromosome numbers of Bulgarian flowering plants. I. Fam. Asteraceae. Fitologija 31: 71–74.
CCDB · ipcn-api-dl — Colombo, P. & C. Marceno. 1984. Etude cytotaxinomique de "Centaurea macroacantha" Guss. et son affinite avec "Centaurea clacitrapa" L. Webbia 38: 665–669.
CCDB · ipcn-api-dl — Hellwig, F. H. 1994. Chromosomenzahlen aus der Tribus Cardueae (Compositae). Willdenowia 24: 219–248.
CCDB · ipcn-api-dl — Tonian, T. R. 1980. Relation between chromosome number and some morphological features of Centaureinae Less representatives. Rev. Biol. 33 (5): 552–554.
CCDB · ipcn-api-dl — Villa, R. 1980. Numeri cromosomici per la Flora Italiana: 733-741. Inform. Bot. Ital. 12: 155–160.
CCDB · ipcn-api-dl — Kamel. 2004. Cytotaxonomical investigations of the Egyptian Compositae (Asteraceae): I---Cardueae and Cichorieae. Compositae Newslett. 41: 9–28.
CCDB · book-ipcn67-71 — TONJAN, Z.R. 1968. The chromosome numbers of some species of the genus Centaurea. (In Russian) Biol. Zurn. Arm. S.S.R. 21: 86-96.
CCDB · book-ipcn67-71 — GUINOCHET, M. 1957. Contribution a l'etude caryologique du genre Centaurea L. sens. lat. soc. Hist. Nat. Afrique Nord 48: 282-300.
CCDB · book-ipcn67-71 — FERNANDES, A., & M. QUEIROS. 1971. Contribution a la connaissance cytotaxinomique des Spermatophyta du Portugal. II Compositae Bol. soc. Brot. 45 (ser. 2l: 5-122.
CCDB · book-ipcn73-74 — LOEVE, A., & E. KJELLQVIST. 1974. Cytotaxonomy of Spanish plants. IV. Dicotyledons: Caesalpiniaceae- Asteraceae. Lagascalia 4: 153-211.
CCDB · book-ipcn73-74 — FERNANDEZ MORALES, M.J. 1974. In IOPB chromosome number reports XLVJ Taxon 23: 801-812. I
CCDB · book-ipcn73-74 — POWELL, A.M., D.W. KYHOS, & P.H. RAVEN. 1974. Chromosome numbers in Compositae. X. Amer. J. Bot. 61: 909-913.
CCDB · book-indian_vol1 — Vignoli, L. 1945 ; Heiser, C.B. & Whi- taker, T. W. 1948 ; Guinochet, M. 1957; Tonjan, Z.R. 1968b ; Fernandes, A. & Queiros, M. 1971 ; Morales, M.J.F. 1974; Powell, A.M. et al. 1974
CCDB · eflora
CCDB · book-atlas-flowering-plants — Vignoli 1945b
CCDB · book-atlas-flowering-plants — Cauc., Asia Min.
CCDB · kew — Garcia S, Hidalgo O, Jakovljević I, Siljak-Yakovlev S, Vigo J, Garnatje T, Vallès J. 2013. New data on genome size in 128 Asteraceae species and subspecies, with first assessments for 40 genera, 3 tribes and 2 subfamilies. Plant Biosystems 147: 1219-1227.
CCDB · Cave1962 — Guinochet & F. 1962
CCDB · CromoCat 2015 — Kamel (2004). Cytotaxonomical investigations of the Egyptian Compositae (Asteraceae): I—Cardueae and Cichorieae. Compositae Newslett. 41: 9–28.
CCDB · CromoCat 2015 — Baltisberger, M. & Lippert, W. (1987). Compositen aus Albanien. Candollea 42: 679-691.
CCDB · CromoCat 2015 — Fernandes, A. & Queirós, M. (1971a). Contribution à la connaissance cytotaxinomique des spermatophyta du Portugal. II. Compositae. Bol. Soc. Brot. 45: 5-122.
CCDB · CromoCat 2015 — Fernández Morales, M. J. (1974a). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports XLVI]. Taxon 23(5/6): 805.
CCDB · CromoCat 2015 — Fernández Morales, M. J. (1974b). Estudios citogenéticos en especies españolas del género Centaurea. Granada
CCDB · CromoCat 2015 — Gardou, C. (1972b). Recherches biosystématiques sur la Section Jacea Cass. et quelques Sections voisines du genre Centaurea L. en France et dans les régions limitrophes. Feddes Repert. 83: 311-472.
CCDB · CromoCat 2015 — Guinochet, M. (1957). Contribution à l'étude caryologique du genre Centaurea L. s.l. Bull. Soc. Hist. Nat. Afrique N. 48: 282-300.
CCDB · CromoCat 2015 — Heiser, C. B. & Whitaker, T. W. (1948). Chromosome number, polyploidy and growth habit in California weeds. Amer. J. Bot. 35(3): 179-186.
CCDB · CromoCat 2015 — Hellwig, F. H. (1994). Chromosomenzahlen aus der Tribus Cardueae (Compositae). Willdenowia 24: 219-248.
+5 more references
n 108×CCDB · iber-fl · CCDB · book-ipcn73-74 · CCDB · CromoCat 2015
CCDB · iber-fl — Estudios citogenticos en especies espaolas del gnero Centaurea. Granada. Fernndez Morales, M. J.*(1974).
CCDB · iber-fl — IOPB. Chromosome number reports. XLVI. Fernndez Morales, M. J.Taxon23(5/6): 805(1974).
CCDB · book-ipcn73-74 — FERNANDEZ MORALES, M.J. 1974. In IOPB chromosome number reports XLVJ Taxon 23: 801-812. I
CCDB · book-ipcn73-74 — POWELL, A.M., D.W. KYHOS, & P.H. RAVEN. 1974. Chromosome numbers in Compositae. X. Amer. J. Bot. 61: 909-913.
CCDB · CromoCat 2015 — Fernández Morales, M. J. (1974a). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports XLVI]. Taxon 23(5/6): 805.
CCDB · CromoCat 2015 — Fernández Morales, M. J. (1974b). Estudios citogenéticos en especies españolas del género Centaurea. Granada
CCDB · CromoCat 2015 — Heiser, C. B. & Whitaker, T. W. (1948). Chromosome number, polyploidy and growth habit in California weeds. Amer. J. Bot. 35(3): 179-186.
CCDB · CromoCat 2015 — Powell, A. M., D. W. Kyhos & P. H. Raven. (1974). Chromosome numbers in Compositae. X. Amer. J. Bot. 61: 909-913.
n 01×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Kamel (2004). Cytotaxonomical investigations of the Egyptian Compositae (Asteraceae): I—Cardueae and Cichorieae. Compositae Newslett. 41: 9–28.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type23 273 records
Wild obs. + sensor20 307
Museum / vouchered2 254
Cultivated / captive5
Other707
Origin
Native1 666
Introduced2 517
Range
Area of Occupancy AOO45 180 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy50% within 1 km
≤100 m 4 364≤1 km 3 790≤10 km 7 911>10 km 194
16 259 georeferenced · 4 048 without coordinates
Open the mapobservation + sensor20 307
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy49% within 1 km
≤100 m 108≤1 km 470≤10 km 524>10 km 66
1 168 georeferenced · 1 086 without coordinates
Open the institutions mapphysical evidence2 254
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
≤10 km 3
3 georeferenced · 2 without coordinates
Open the mapnot free-living5
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions89 of 159 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| BIO-UNIPIlocation not on record | 177 |
| Adelaide, AU | 137 |
| Berlin, DE | 119 |
| Mount Annan, AU | 88 |
| Canadian Department of Agriculturelocation not on record | 78 |
| MeiseBGlocation not on record | 78 |
| Museo Entomologico de Leonlocation not on record | 64 |
| South Kensington, GB | 59 |
| València, ES | 51 |
| Canberra, AU | 49 |
| BDBClocation not on record | 45 |
| MAlocation not on record | 45 |
| Barcelona, ES | 43 |
| Adam Mickiewicz University in Poznańlocation not on record | 41 |
| LDlocation not on record | 40 |
| QAUlocation not on record | 38 |
| BClocation not on record | 36 |
| Vitoria, ES | 36 |
| Entomological Society of Latvialocation not on record | 33 |
| Philadelphia, US | 26 |
| San Luis Obispo, US | 25 |
| Brisbane, AU | 25 |
| Pamplona, ES | 24 |
| College of the Atlantic, Museumlocation not on record | 21 |
| Bern, CH | 20 |
| Madrid, ES | 20 |
| Jaén, ES | 19 |
| Granada, ES | 19 |
| Córdoba, AR | 19 |
| San Sebastián, ES | 19 |
| Córdoba, ES | 18 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 18 |
| San Isidro, AR | 16 |
| Sevilla, ES | 14 |
| Santa Barbara, US | 14 |
| Christchurch, NZ | 14 |
| Davis, US | 14 |
| Riverside, US | 14 |
| ISAlocation not on record | 14 |
| University of Stellenboschlocation not on record | 13 |
| Kensington, AU | 13 |
| Alicante, ES | 12 |
| Salamanca, ES | 12 |
| Armidale, AU | 11 |
| Auckland, NZ | 11 |
| UChlocation not on record | 11 |
| San Diego, US | 10 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 10 |
| CICYTEXlocation not on record | 10 |
| Wlocation not on record | 9 |
| Badajoz, ES | 9 |
| Claremont, US | 9 |
| Moscow State Universitylocation not on record | 9 |
| Pretoria, ZA | 8 |
| BFLlocation not on record | 8 |
| Görlitz, DE | 8 |
| Hobart, AU | 7 |
| Bronx, US | 7 |
| CASlocation not on record | 7 |
| Chongqing Museumlocation not on record | 6 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 6 |
| Pullman, US | 5 |
| Pamplona, ES | 5 |
| EEZA-CSIClocation not on record | 5 |
| UIBlocation not on record | 5 |
| Bourges, FR | 5 |
| Kew, GB | 5 |
| John T. Waterhouse Herbariumlocation not on record | 5 |
| Wellington, NZ | 5 |
| IDElocation not on record | 4 |
| JBSlocation not on record | 4 |
| Karlsruhe, DE | 4 |
| Fundación Miguel Lillolocation not on record | 4 |
| BSBIlocation not on record | 4 |
| CJBGlocation not on record | 4 |
| Phyletisches Museum Jenalocation not on record | 4 |
| Paris, FR | 4 |
| Laboratory of Palaeontologylocation not on record | 4 |
| UGentlocation not on record | 3 |
| PRClocation not on record | 3 |
| Agriculture and Agri-Food Canada, Vascular Plant Herbariumlocation not on record | 3 |
| Museo Achille Folettolocation not on record | 3 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 3 |
| Oskarshamn, SE | 3 |
| Brussel, BE | 3 |
| BRNUlocation not on record | 3 |
| National Museum Waleslocation not on record | 3 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 3 |
| Wuzhou, CN | 3 |
| Salzburg, AT | 3 |
| Frankfurt am Main | 2 |
| Santa Cruz, US | 2 |
| Angwin, US | 2 |
| Hunan Geological Museumlocation not on record | 2 |
| Los Angeles, US | 2 |
| Coimbra, PT | 2 |
| OLAlocation not on record | 2 |
| Uppsala, SE | 2 |
| Davenport, US | 2 |
| University of Guelph, OAC Herbariumlocation not on record | 2 |
| Saint Louis, US | 2 |
| Corrientes, AR | 2 |
| US | 2 |
| EL PASO, US | 2 |
| NSW Dept of Planning, Industry and Environmentlocation not on record | 2 |
| Parkville, AU | 2 |
| Gijón, ES | 2 |
| San Francisco, US | 2 |
| Dekalb, US | 2 |
| Valparaíso, CL | 2 |
| Uniwersytet Śląski w Katowicachlocation not on record | 2 |
| Severin-McDaniel Insect Collectionlocation not on record | 1 |
| Musée des Confluenceslocation not on record | 1 |
| Giardini Botanici Hanburylocation not on record | 1 |
| Bloomington, US | 1 |
| Trondheim, NO | 1 |
| Hazara Universitylocation not on record | 1 |
| Nantes Culture Collectionlocation not on record | 1 |
| Natural History Museum Rotterdamlocation not on record | 1 |
| Austin, US | 1 |
| Castelar, AR | 1 |
| Salvador, BR | 1 |
| Bangkok, TH | 1 |
| RJBJCIlocation not on record | 1 |
| Viña del Mar, CL | 1 |
| Monastir, TN | 1 |
| Museo della Bonifica di San Donà di Piavelocation not on record | 1 |
| Bureau of Land Management, Medford District Officelocation not on record | 1 |
| H-Meierottlocation not on record | 1 |
| US | 1 |
| Smithfield, AU | 1 |
| Palmerston North, NZ | 1 |
| Burlington, US | 1 |
| San Jose, US | 1 |
| Provincia di Livornolocation not on record | 1 |
| Department of Bacteriology, University of Wisconsinlocation not on record | 1 |
| Porrentruy, CH | 1 |
| Podgorica, ME | 1 |
| Herbario Universidad de Concepciónlocation not on record | 1 |
| Naturalis Biodiversity Centerlocation not on record | 1 |
| MMHNSRlocation not on record | 1 |
| Turku, FI | 1 |
| Columbia, US | 1 |
| Banyoles, ES | 1 |
| LfUlocation not on record | 1 |
| Mlocation not on record | 1 |
| New Brunswick, US | 1 |
| Oulu, FI | 1 |
| University of New Hampshirelocation not on record | 1 |
| IPE-CSIClocation not on record | 1 |
| Washington, US | 1 |
| TUR-Alocation not on record | 1 |
| Zürich, CH | 1 |
| Arcata, US | 1 |
| Dresden, DE | 1 |
| San Diego Natural History Museumlocation not on record | 1 |
| WTUlocation not on record | 1 |
| Joondalup, AU | 1 |
| BAlocation not on record | 1 |
159 institutions · 2 038 of 2 254 vouchered records shown · 215 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA19 detections
Where the DNA of Centaurea calcitrapa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found19
Studies independent surveys1
Countries6
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 19 detections have coordinates
Open the map6 countries0
Phenology=FL
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median15.9 °C 2.70–18.5
Seasonal swing summer↔winter15.8 °C
Max temp (day)17.3 °C 5.70–22.9
Min temp (night)12.6 °C -0.1–14.7
Precipitation73.5 mm/mo 42.6–90.9
Air humidity63.6 % 58.3–67.5
Moisture balance18.9 mm/mo
Vapour deficit651 Pa 251–876
Wind speed3.30 m/s
Cloud cover42.3 % 34.0–49.7
CHELSA 1981–2010, ~9 km grid, at location & month of 10 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.