Cenchrus echinatus
speciesAt a glance
Occurrence records8 390
Data sources14
Biological traits41
DNA specimens50
eDNA detections17
Sources14 archives
Databases and archives Cenchrus echinatus's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility8 379 records↗
OBISOcean Biodiversity Information System11 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI17 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics50 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
giftgenome & karyotype
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
WikidataWikimedia Foundationstructured facts↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources41 traits
Chemical compositionLOTUS6 compounds
Occurrence & distributionGBIF · OBIS8 390 records
Environmental DNA1 datasets · 8 countries17 detections
DNA & barcodingBOLD · NCBI50 specimens
Genome at a glanceCCDB · GIFT2.5 Gbp
01Narrative
Cenchrus echinatus, connue sous les noms vernaculaires de Cenchre épineux, herbe pagode, gratte-cul ou cram-cram, est une espèce de plantes herbacées épineuses de la famille des Poaceae dont les grains s'accrochent au poil des animaux et aux vêtements. Originaire d'Amérique centrale, elle est introduite et envahissante dans la plupart des zones tropicales.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPGIFTAusTraitsTRY
Size & morphology16
Fruit length2.9 mm
Inflorescence length max7.0 cm
Inflorescence length min3 cm
Leaf length145 mm
Leaf length max200 mm
Leaf length min50 mm
Leaf size566 mm²
Leaf width6.5 mm
Leaf width max12 mm
Leaf width min2 mm
Plant height0.4 m
⚠ sources differ — GIFT: 0.4 m · AusTraits: 0.6 m · TRY: 1 m
Plant height max0.9 m
Plant height min0 m
Seed mass17.2 mg
Seed mass max17.2 mg
Seed mass min17.2 mg
Life cycle & reproduction9
Dehiscenceindehiscent
Dispersal typeanimal+wind
⚠ sources differ — AusTraits: anemochory epizoochory · GIFT: zoochorous
Flowering timeyynnnnnnnnny
Life formannual
Life spanannual
Pollination syndromewind
Raunkiær life formtherophyte
Resprouting capacityfire_killed
Sex typehermaphrodite
Diet & foraging1
Parasiteindependent
Habitat & environment13
Aquaticterrestrial
Climateseasonally dry tropical
Climberself-supporting
Elevation max1 500 m
Elevation min0 m
Epiphyteterrestrial
Fruit fleshinessdry
Fruit typecaryopsis
⚠ sources differ — AusTraits: caryopsis · GIFT: achene
Growth formherb
⚠ sources differ — GIFT: herb · AusTraits: tussock · TRY: Herb
Habitat GIFTÁrea Antrópica, Caatinga (stricto sensu), Cerrado (lato sensu), Floresta Ciliar ou Galeria, Floresta Ombrófila (= Floresta Pluvial), Restinga
Leaf compoundnesssimple
Succulenceno
Woodinessnon-woody
Physiology & chemistry1
Photosynthetic pathwayC4
Other traits1
Shoot orientationascending
03Chemical composition6 compounds
Compounds documented for Cenchrus echinatus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile1 class
Ergot alkaloids6
Documented compounds6 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (6aR,9S)-N-[(2R,5S,8S,8aS)-8a-hydroxy-2,8-dimethyl-5-(2-methylpropyl)-3,6-dioxo-7,8-dihydro-5H-[1,3]oxazolo[3,2-a]pyrazin-2-yl]-7-methyl-6,6a,8,9-tetrahydro-4H-indolo[4,3-fg]quinoline-9-carboxamide | present | LOTUS | |
| 12'-Hydroxy-2'-methyl-3',6',18-trioxo-5'alpha-(propan-2-yl)-5alpha-ergotaman | present | LOTUS | |
| Ergobalansine | present | LOTUS | |
| Ergotamine | present | LOTUS | |
| Ergovaline | present | LOTUS | |
| Ergovalinine | present | LOTUS |
05DNA & barcoding50 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cenchrus echinatus has left across the world's sequence archives.
At a glance
DNA specimens50
Marker genes6
GenBank sequences10
eDNA detections17
Countries9
The DNA barcodea real sequence read deposited for this species
TATGCGATACTTGGTGTGAATTGCAGAATCCCGCGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCTTCTGGCTGAGGGCACG …
Cenchrus echinatus isolate Peru18285 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK3★rbcL4★rbcLa★ITS3★ITS2trnH-psbA
plant barcodefungal barcodemarker
06Genome at a glanceCCDB · GIFT
The complete instruction manual Cenchrus echinatus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size2 542 800 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Cenchrus echinatus2.54 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 68 n = 34
Ploidy2× diploid · measured
Chromosome records34–702n range68median68mode9records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 686×CCDB · book-ipcn67-71 · CCDB · book-ipcn73-74 · CCDB · Cave1956supp +1
CCDB · book-ipcn67-71 — GOULD, F.W. 1968. Chromosome numbers of Texas grasses. Canad. J. Bot. 46: 1315-1325.
CCDB · book-ipcn67-71 — GOULD, F.W., & T.R. SODERSTROM. 1970. Chromosome numbers of some Mexican and Colombian grasses. Canad. J. Bot. 48: 1633-1639.
CCDB · book-ipcn67-71 — GOULD, F. W., & T. R. SODERSTROM. 1967. Chromosome numbers of tropical American grasses. Arn. Jour. Bot. 54: 676-683.
CCDB · book-ipcn73-74 — GOULD, F.W., & T.R. SODERSTROM. 1974. Chromosome numbers of some Ceylon grasses. Canad. J. Bot. 52: 1075-1090.
CCDB · Cave1956supp — Tateoka 1955
GIFT · GIFT (floras)
2n 342×CCDB · book-atlas-flowering-plants · GIFT · GIFT (floras)
CCDB · book-atlas-flowering-plants — Fo
GIFT · GIFT (floras)
2n 701×CCDB · book-ipcn65
CCDB · book-ipcn65 — Gould 1965
n 343×CCDB · book-ipcn67-71 · CCDB · book-ipcn73-74 · CCDB · Cave1963
CCDB · book-ipcn67-71 — CRANG, R.E., & H.L. DEAN. 1971. An intergeneric hybrid in the Sileneae (Caryophyllaceael. Bull. Torrey Bot. Club. 98: 214-217.
CCDB · book-ipcn73-74 — DAVIDSE, G., & R.W. POHL. 1974. Chromosome numbers, meiotic behavior, and notes on tropical American grasses (Gramineae). Canad. J. Bot. 52: 317-328.
CCDB · Cave1963 — DeLisle 1963
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GIFT · GIFT (floras)
GIFT · GIFT (floras)
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type8 390 records
Wild obs. + sensor3 578
Museum / vouchered4 553
Other259
Origin
Native405
Introduced110
Range
Area of Occupancy AOO20 740 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy89% within 1 km
≤100 m 1 967≤1 km 255≤10 km 156>10 km 106
2 484 georeferenced · 1 094 without coordinates
Open the mapobservation + sensor3 578
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy66% within 1 km
≤100 m 1 046≤1 km 167≤10 km 449>10 km 163
1 825 georeferenced · 2 728 without coordinates
Open the institutions mapphysical evidence4 553
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions157 of 323 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Brisbane, AU | 278 |
| Durango, MX | 271 |
| Saint Louis, US | 261 |
| Mexico City, MX | 201 |
| University of Stellenboschlocation not on record | 200 |
| Sydney, AU | 165 |
| Bronx, US | 154 |
| Palmerston, AU | 114 |
| Canberra, AU | 100 |
| BISHlocation not on record | 94 |
| Honolulu, US | 94 |
| Tampa, US | 70 |
| Austin, US | 63 |
| San Isidro, AR | 63 |
| Mount Annan, AU | 58 |
| San Diego, US | 58 |
| Kew, GB | 58 |
| Université de Bordeauxlocation not on record | 57 |
| UNESP-ISlocation not on record | 49 |
| Kensington, AU | 49 |
| Ann Arbor, US | 48 |
| Brasília, BR | 42 |
| Mérida, MX | 39 |
| Université de Strasbourglocation not on record | 39 |
| Instituto de Investigaciones Biológicas, Universidad Veracruzana, Región Xalapalocation not on record | 38 |
| Guasave, MX | 38 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 34 |
| Xiamen, CN | 33 |
| Taipei, TW | 32 |
| Paris, FR | 32 |
| Jena Microbial Resource Collectionlocation not on record | 31 |
| Museo Entomologico de Leonlocation not on record | 29 |
| Auckland, NZ | 26 |
| Riverside, US | 26 |
| St. Augustine, TT | 26 |
| UnBlocation not on record | 24 |
| Ciudad de México, MX | 23 |
| Taipei, TW | 23 |
| Bloomington, US | 23 |
| Smithfield, AU | 22 |
| Universidade Federal do Rio Grande do Nortelocation not on record | 22 |
| TAIElocation not on record | 22 |
| Chapingo, MX | 21 |
| UNIVASFlocation not on record | 21 |
| Comisión Técnico Consultiva de Coeficientes de Agostaderolocation not on record | 21 |
| KMCClocation not on record | 20 |
| Adelaide, AU | 20 |
| Ciudad de México, MX | 20 |
| Odawara, JP | 19 |
| Masindi, UG | 18 |
| Cenargenlocation not on record | 17 |
| UFERSAlocation not on record | 17 |
| Salvador, BR | 17 |
| Torreón, MX | 16 |
| Mexico City, MX | 16 |
| Culiacán, MX | 15 |
| Istituto Agrario Castelnuovolocation not on record | 15 |
| ASUlocation not on record | 15 |
| Claremont, US | 15 |
| UFMSlocation not on record | 14 |
| Brasília, BR | 14 |
| Universidade Federal do Maranhãolocation not on record | 14 |
| Laboratorio de Ictiologialocation not on record | 14 |
| Departamento de Sistematica e Ecologialocation not on record | 13 |
| Ciudad Autónoma de Buenos Aires, AR | 13 |
| Corrientes, AR | 13 |
| Juriquilla, MX | 13 |
| Miami, US | 13 |
| UFESlocation not on record | 13 |
| Mérida, MX | 13 |
| Nishihara, JP | 12 |
| Universidade Federal de Sergipe (UFS)location not on record | 12 |
| Valdosta State Universitylocation not on record | 12 |
| Aarhus, DK | 12 |
| UFRPElocation not on record | 12 |
| Chaguaramas, TT | 11 |
| National Biodiversity Institute, Costa Ricalocation not on record | 11 |
| Puerto Ayora, EC | 10 |
| Canadian Department of Agriculturelocation not on record | 10 |
| Sanda, JP | 10 |
| Feira de Santana, BR | 10 |
| Zacatecas, MX | 10 |
| La Paz, MX | 10 |
| Chongqing Museumlocation not on record | 9 |
| WTUlocation not on record | 9 |
| GAlocation not on record | 9 |
| Davis, US | 9 |
| IPA/SPlocation not on record | 9 |
| California Academy of Scienceslocation not on record | 9 |
| Federal University of Espírito Santolocation not on record | 8 |
| Tapachula, MX | 8 |
| Cuiabá, BR | 8 |
| J.F.Oberlin Universitylocation not on record | 8 |
| John T. Waterhouse Herbariumlocation not on record | 8 |
| UFBAlocation not on record | 8 |
| Universidad Nacional de Asunciónlocation not on record | 8 |
| CJBGlocation not on record | 8 |
| UFPElocation not on record | 8 |
| Albuquerque, US | 8 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 8 |
| Empresa Pernambucana de Pesquisa Agropecuária, IPAlocation not on record | 8 |
| Universidad Nacional de Colombia (UNAL)location not on record | 8 |
| Universidad del Quindío (UniQuindío)location not on record | 7 |
| Plocation not on record | 7 |
| Antiguo Cuscatlán, SV | 7 |
| EL PASO, US | 7 |
| Fort Worth, US | 7 |
| Hermosillo, MX | 7 |
| Bangkok, TH | 7 |
| JBRJlocation not on record | 7 |
| Armidale, AU | 7 |
| Parc Botanique et Zoologique de Tsimbazaza (PBZT)location not on record | 7 |
| Agriculture and Agri-Food Canada, Vascular Plant Herbariumlocation not on record | 6 |
| Mexico City, MX | 6 |
| Taipei, TW | 6 |
| Loja, EC | 6 |
| MeiseBGlocation not on record | 6 |
| Universidade Federal do Ceara, Departamento de Biologialocation not on record | 6 |
| Tuscaloosa, US | 6 |
| UFSClocation not on record | 6 |
| Christchurch, NZ | 6 |
| Córdoba, AR | 5 |
| Kagoshima, JP | 5 |
| James Cook Townsvillelocation not on record | 5 |
| Chicago, US | 5 |
| BAYLUlocation not on record | 5 |
| LDlocation not on record | 5 |
| Toluca, MX | 5 |
| US | 5 |
| MEXUlocation not on record | 5 |
| Wuzhou, CN | 5 |
| AUAlocation not on record | 5 |
| Universidad Juárez Autónoma de Tabascolocation not on record | 5 |
| Conservatoire Botanique National de Mascarinlocation not on record | 4 |
| Cambridge, US | 4 |
| Flagstaff, US | 4 |
| Austin, US | 4 |
| Moscow State Universitylocation not on record | 4 |
| Logan, US | 4 |
| The University of Arizonalocation not on record | 4 |
| Tall Timbers Research Stationlocation not on record | 4 |
| Beijing, CN | 4 |
| University of Papua New Guinealocation not on record | 4 |
| Brussel, BE | 4 |
| San Francisco de Campeche, MX | 4 |
| PUC-RSlocation not on record | 4 |
| CEPLAClocation not on record | 4 |
| Autlán de Navarro, MX | 4 |
| Hobart, AU | 4 |
| Blumenau, BR | 4 |
| Tsukuba, JP | 3 |
| Pontifícia Universidade Católica do Paranálocation not on record | 3 |
| UTFPR-CPlocation not on record | 3 |
| Paleontological Collectionlocation not on record | 3 |
| South Kensington, GB | 3 |
| International Salmonella Centre (W.H.O.)location not on record | 3 |
| Ivano-Frankivsk, UA | 3 |
| Bogotá, D.C., CO | 3 |
| Giardini Botanici Hanburylocation not on record | 3 |
| San Luis Obispo, US | 3 |
| Universidad Nacional del Litorallocation not on record | 3 |
| Santa Barbara, US | 3 |
| UNESP-FCAlocation not on record | 3 |
| Museo Athanasius Kircher di Romalocation not on record | 3 |
| Columbia, US | 3 |
| Frankfurt am Main | 3 |
| Centro de Pesquisas Agropecuarias do Tropico Umidolocation not on record | 3 |
| CPATSAlocation not on record | 3 |
| HACAMlocation not on record | 3 |
| Maringá, BR | 3 |
| HUENFlocation not on record | 3 |
| Santarém, BR | 3 |
| Campo Mourão, BR | 3 |
| UEMlocation not on record | 3 |
| Puebla, MX | 3 |
| CASlocation not on record | 3 |
| IECOSlocation not on record | 3 |
| Clemson, US | 3 |
| Phoenix, US | 3 |
| Burlington, US | 3 |
| Forest Herbarium Ibadan (FHI)location not on record | 2 |
| Montecillo, Texcoco, MX | 2 |
| Tuxtla Gutiérrez, MX | 2 |
| Jardín Botánico de Cartagena "Guillermo Piñeres" (JBC)location not on record | 2 |
| Universidad de Buenos Aireslocation not on record | 2 |
| Uniwersytet Jagiellońskilocation not on record | 2 |
| Santa Cruz de la Sierra, BO | 2 |
| Guatemala City, GT | 2 |
| MAlocation not on record | 2 |
| BAlocation not on record | 2 |
| Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record | 2 |
| San José, CR | 2 |
| Castelar, AR | 2 |
| Knoxville, US | 2 |
| UTPLlocation not on record | 2 |
| Fortaleza, BR | 2 |
| GB | 2 |
| Université du Lomélocation not on record | 2 |
| Guilin, CN | 2 |
| Altos de Pipe, VE | 2 |
| Toyama, JP | 2 |
| Baroda, IN | 2 |
| Vancouver, CA | 2 |
| Jackson, US | 2 |
| DOI/NPS, Mississippi National River & Recreation Arealocation not on record | 2 |
| UNIVILLElocation not on record | 2 |
| Montréal, CA | 2 |
| UNESClocation not on record | 2 |
| Museu Paraense Emílio Goeldilocation not on record | 2 |
| Adam Mickiewicz University in Poznańlocation not on record | 2 |
| Universidade Federal de Santa Catarinalocation not on record | 2 |
| Denver, US | 2 |
| Pretoria, ZA | 2 |
| Northridge, US | 2 |
| URCAlocation not on record | 2 |
| INMAlocation not on record | 2 |
| Universidade Federal do Espírito Santolocation not on record | 2 |
| OTSlocation not on record | 2 |
| Cusco, PE | 2 |
| HNBlocation not on record | 2 |
| Jataí / Setor Industrial, BR | 2 |
| San Angelo, US | 2 |
| Universidad de Caldas (UCaldas)location not on record | 2 |
| Los Angeles, US | 2 |
| TNMlocation not on record | 2 |
| University of Zhejianglocation not on record | 1 |
| DOI/NPS, Greenbelt Parklocation not on record | 1 |
| New Mexico State Universitylocation not on record | 1 |
| Badajoz, ES | 1 |
| UFOPlocation not on record | 1 |
| Sendai, JP | 1 |
| China Agricultural Universitylocation not on record | 1 |
| Arequipa, PE | 1 |
| UNITINSlocation not on record | 1 |
| Toronto, CA | 1 |
| Universidad Industrial de Santander (UIS)location not on record | 1 |
| UEMAlocation not on record | 1 |
| NHMJlocation not on record | 1 |
| Cascavel, BR | 1 |
| Centro de Investigación en Biodiversidad y Conservación, Universidad Autónoma del Estado de Moreloslocation not on record | 1 |
| Facultad de Zootecnia y Ecología, Universidad Autónoma de Chihuahualocation not on record | 1 |
| Fundación Miguel Lillolocation not on record | 1 |
| Wlocation not on record | 1 |
| UNICAMPlocation not on record | 1 |
| Long Beach, US | 1 |
| Centro de Investigación Regional Norte Centro, Campo Experimental La Campana, Instituto Nacional de Investigaciones Forestales, Agrícolas y Pecuariaslocation not on record | 1 |
| Minia, EG | 1 |
| Tomioka, JP | 1 |
| UNESP, Campus São José Rio Prêtolocation not on record | 1 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 1 |
| Herbier National du Gabonlocation not on record | 1 |
| UFMGlocation not on record | 1 |
| Uppsala, SE | 1 |
| Instituto Nacional de Pesquisas da Amazônia (INPA)location not on record | 1 |
| Audubon Society -- Silver Bluff Audubon Center and Sanctuarylocation not on record | 1 |
| BMlocation not on record | 1 |
| Angwin, US | 1 |
| Severin-McDaniel Insect Collectionlocation not on record | 1 |
| Ilhéus, BR | 1 |
| UFABClocation not on record | 1 |
| Santa Teresa, BR | 1 |
| USP-IBlocation not on record | 1 |
| MUFALlocation not on record | 1 |
| Criciúma, BR | 1 |
| NSW Dept of Planning, Industry and Environmentlocation not on record | 1 |
| Universidade de São Paulolocation not on record | 1 |
| San Diego Natural History Museum, Herbariumlocation not on record | 1 |
| University of North Carolina at Pembrokelocation not on record | 1 |
| Leiden University Medical Centerlocation not on record | 1 |
| UChlocation not on record | 1 |
| Sangmiung Universitylocation not on record | 1 |
| Irvine, US | 1 |
| Rishon Le Zion, IL | 1 |
| Universidad Nacional de Cajamarcalocation not on record | 1 |
| Centro de Estudios y Colecciones Biológicas para la Conservaciónlocation not on record | 1 |
| La Paz, BO | 1 |
| Stephenville, US | 1 |
| FUVATESlocation not on record | 1 |
| LGlocation not on record | 1 |
| Durham, US | 1 |
| Ensenada, MX | 1 |
| Conservatoire Botanique National de Mascarinlocation not on record | 1 |
| León, NI | 1 |
| Universidad Nacional Agrarialocation not on record | 1 |
| Instituto de Ecología Aplicada, Universidad Autónoma de Tamaulipaslocation not on record | 1 |
| Zapopan, MX | 1 |
| Cruz das Almas, BR | 1 |
| Glocation not on record | 1 |
| Department of Land Resources Managementlocation not on record | 1 |
| UFRRJlocation not on record | 1 |
| CUVClocation not on record | 1 |
| Arcata, US | 1 |
| Universidad de El Salvadorlocation not on record | 1 |
| Madison, US | 1 |
| UCAMlocation not on record | 1 |
| Nishihara, JP | 1 |
| San Luis Potosí, MX | 1 |
| UNESP-FCAVlocation not on record | 1 |
| Due West, US | 1 |
| Salamanca, ES | 1 |
| Universität Göttingenlocation not on record | 1 |
| Universidad Nacional Mayor de San Marcos, Museo de Historia Naturallocation not on record | 1 |
| BGPAlocation not on record | 1 |
| ESALQlocation not on record | 1 |
| Gump Stationlocation not on record | 1 |
| Sociedad para el Estudio de los Recursos Bióticos de Oaxaca, A. C.location not on record | 1 |
| Beijing, CN | 1 |
| Provo, US | 1 |
| BRNUlocation not on record | 1 |
| Universidad Pedagógica y Tecnológica de Colombia (UPTC)location not on record | 1 |
| Edinburgh, GB | 1 |
| QAUlocation not on record | 1 |
| Oskarshamn, SE | 1 |
| TAFORI-LSRClocation not on record | 1 |
| Dekalb, US | 1 |
| Universidade Federale do Rio Grande do Sullocation not on record | 1 |
| Uniwersytet Śląski w Katowicachlocation not on record | 1 |
| UFSMlocation not on record | 1 |
| DanBIFlocation not on record | 1 |
| Museo naturalistico del Frignano Ferruccio Minghellilocation not on record | 1 |
| Columbus State University Herbariumlocation not on record | 1 |
| UNEMATlocation not on record | 1 |
| Asheville, US | 1 |
323 institutions · 4 409 of 4 553 vouchered records shown · 133 without an institution code
09Environmental DNA17 detections
Where the DNA of Cenchrus echinatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found17
Studies independent surveys1
Countries8
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 17 detections have coordinates
Open the map8 countries0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median22.3 °C 15.7–26.1
Seasonal swing summer↔winter8.50 °C
Max temp (day)26.8 °C 20.2–30.2
Min temp (night)18.6 °C 9.00–22.6
Precipitation45.4 mm/mo 1.10–239
Air humidity61.4 % 50.9–66.5
Moisture balance-59.4 mm/mo
Vapour deficit946 Pa 770–1,362
Wind speed3.80 m/s
Cloud cover26.2 % 12.6–63.2
CHELSA 1981–2010, ~9 km grid, at location & month of 10 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.